1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
15

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Biology
1 answer:
Eddi Din [679]3 years ago
4 0

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

You might be interested in
When a small number of individuals moved to the United States from Germany, they established an Amish population. Why do you oft
slega [8]

Answer:

Alleles that are rare in the ancestral population (Germany) become common in the new population by random chance.

Explanation:

The founder effect is the change in the allele frequencies of a population by a chance event when a small group of individuals migrate from the large original population and colonize a new region. The gene pool of the Amish population is quite different from the original population as the colonizing individuals did not carry all the alleles and genes present in the original population.

The founder effect results in the expression of harmful recessive alleles that were otherwise masked in the heterozygous genotype of the original large population. Small colonizing population exhibits increased homozygosity and reduced genetic variations leading to the expression of rare diseases that were masked by heterozygosity in the large parent population.

4 0
3 years ago
a knife penetrates the lung and enters the heart. name the six membrane layers the blade passes through.
Roman55 [17]

A knife that penetrates the lung and enter the heart would first enter:

(1) parietal pleura

(2) visceral pleura

(3) visceral pleura

(4) parietal pleura

(5) fibrous pericardium

(6) serous pericardium

The first membrane, parietal pleura is the outer covering of the lungs and it attaches to the thoracic cage. The next membrane, visceral pleura is the inner covering of the lungs. The fibrous pericardium, like the parietal pleura, is the outer covering of the heart which anchors the heart to the diaphragm and sternum. The serous pericardium, which is made of two layers, is the inner covering and lines the surface of the heart.

Learn more of membranes from:

brainly.com/question/17373329?referrer=searchResults

#SPJ4

3 0
1 year ago
How are viruses different from bacteria? APEX
andreyandreev [35.5K]

Bacteria are unicellular microorganisms that can be found everywhere in the environment. Viruses are microorganisms that can only reproduce within the cells of a host organism.

The differences between viruses and bacteria include;  

  1. Viruses do not have any cell and are considered between living and non-living things, while bacteria have one cell (Unicellular) and are living organisms.
  2. Viruses are smaller in size (20-400 nm) when compared with bacteria (1000 nm).
  3. Viruses do not have a cell wall but a protein coat is present, while bacteria have a cell wall that is composed of peptidoglycan.
  4. Viruses require a living cell to reproduce, while bacteria can reproduce by itself.
  5. The DNA or RNA of viruses is enclosed inside a coat of protein, while that of bacteria floats freely in the cytoplasm within the cell.
3 0
3 years ago
Read 2 more answers
Which level of a food chain breaks down dead organisms at every other level?
IRISSAK [1]

It should be the trophic level..

7 0
3 years ago
Where on earth can ecological relationships be found
Anastaziya [24]
The definition of an ecological relationship is the relationship between organisms in an ecosystem, so you can find them in almost any ecosystem.
4 0
3 years ago
Other questions:
  • Which biome, typical of Africa, is home to many grazing animals?
    14·1 answer
  • Think about water and how it rolls up on a beach. Think of all it’s wualities. Is it alive according to the characteristics of l
    11·1 answer
  • Where do new genes come from
    8·1 answer
  • Explain how the process of weathering benefits living organisms.
    10·1 answer
  • Choose all the answers that apply.
    12·1 answer
  • This organelle is usually small and round in shape. It breaks down larger food molecules into smaller ones, digests waste, recyc
    12·2 answers
  • Which statements describe advantages of models? Check all that apply.
    11·1 answer
  • Ugg sorry posting so much but now I cant edit! Yes this is what the other 2 are
    5·1 answer
  • After succession, ____________ account for most of the vegetation on the island, leaving some ____________, _____________, _____
    5·1 answer
  • What are the importance of familiarizing the functions of carpentry tools and equipment
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!