1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
4 years ago
15

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Biology
1 answer:
Eddi Din [679]4 years ago
4 0

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

You might be interested in
Which of the following reservoirs contains the most water ?? Hurry
anygoal [31]
Ocean I contains about 97% of all water on earth
5 0
4 years ago
Which of the following is TRUE of a cell membranes?
adoni [48]

Answer:

B, C, Dand E are all correct

Explanation:

Why B is correct- The cell membrane, also known as the plasma membrane, is a double layer of lipids and proteins that surrounds a cell and separates the cytoplasm (the contents of the cell) from its surrounding environment. It is selectively permeable, which means that it only lets certain molecules enter and exit.

Plants, animals, and bacteria have a cell membrane. Why d is correcect

Why C is correct- The cell membrane is not a solid structure. It is made of millions of smaller molecules that create a flexible and porous container. Proteins and phospholipids make up most of the membrane structure.

Why E is correct- The plasma membrane is primarily composed of phospholipids arranged in a bilayer, with the hydrophobic tails on the interior of the membrane, and the hydrophilic heads pointing outwards

Why A Is Not correct- It is very fragile and its role is to hold the cell together and to help control what substances can get in and out. It is partially permeable, allowing only some substances to pass through it. The membrane has a complex structure consisting of a phospholipid bi-layer and different types of proteins.

4 0
3 years ago
WILL GIVE BRAINLIEST, PLEASE HELP ASAP TIME LIMITED WILL:
miss Akunina [59]
50% since in two squares it’ll be YY and the other two it’ll be Yy
7 0
4 years ago
Read 2 more answers
The storage form of carbohydrates is ________ in animals and ________ in plants.
Brums [2.3K]
The storage form of carbohydrates is Glycogen in animals and humans in plants. <span>
</span>
4 0
4 years ago
Plzzzzzzzzzzzzzzzzzzzzzzzz help!<br><br> Where did the chemical reaction take place?
pantera1 [17]
Chemical reactions occur when chemical bonds between atoms are formed or broken. If this is what you mean because the question is really confusing sorry :(
3 0
3 years ago
Other questions:
  • Which term describes the systems of continuous water movement on and in the earth?
    9·1 answer
  • ) Let’s say you are walking around FIU’s preserve, how would you tell if a plant there is a monocot or a eudicot? B) Use the dif
    13·1 answer
  • What is the main criterion that scientists use to decide where to place the boundaries between the major divisions of the geolog
    13·1 answer
  • Which of the following might trigger erythropoiesis?
    5·1 answer
  • The theory of plate tectonics is about the _____.
    8·2 answers
  • A researcher is designing a laboratory experiment to determine whether the inorganic substance A affects the rate of a reaction
    8·1 answer
  • Which is the best description of how a living organism functions
    14·1 answer
  • A mutagenic process that alters the chromosome segment
    15·2 answers
  • he following is NOT true about trophic levels: Primary consumers belong to the first trophic level. Secondary consumers belong t
    10·1 answer
  • What does the Teacher's Pet Video: Mitosis and Meiosis give as the main reason for the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!