1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
14

Describe how the researcher can identify when a climax community is reached.

Biology
1 answer:
GenaCL600 [577]3 years ago
3 0

Answer:

An ecological community in which populations of plants or animals remain stable and exist in balance with each other and their environment. A climax community is the final stage of succession, remaining relatively unchanged until destroyed by an event such as fire or human interference.

Explanation:

You might be interested in
what is the displacement for a driver who travels 10 km to get to a point that is 4 km from his starting point?
kumpel [21]
Displacement is shortest distance from starting point, 4km.
3 0
3 years ago
Read 2 more answers
Taxonomy is a scientific field involving-
sergeinik [125]

Answer:

Taxonomy is a branch of science that classifies, names, and describes organisms.

7 0
3 years ago
Birds and mammals have a four-chambered heart, but most reptiles have a three-chambered heart. How does this fact affect the con
eduard

Answer:

The animals present body structure is due to evolution. It is seen in each part including the structure of the heart. The vertebrate heart becomes complex from a simpler form.  

Invertebrates, the heart of fishes is two-chambered having one auricle and one ventricle. The deoxygenated blood gets purified in the gills. They are aquatic and no lungs for breathing. The hearts pump a mixture of oxygenated and deoxygenated blood to the body.  

The amphibians and reptiles have 3 chambered heart as they lead terrestrial mode of life. The gills modified into the lungs.  The left auricle receives pure blood and the right auricle receives deoxygenated blood. The blood purified in the lungs and in the ventricle, both types of blood get a mix. The ventricle pumps the mixed-blood throughout the body.

In the case of birds and mammal, the heart is 4 chambered and the oxygenated and deoxygenated blood are separated. These two are higher vertebrates. No mix of pure and impure blood, the body receives only the oxygenated blood.

This shows to construct the phylogenetic tree of vertebrates - the fishes should be in the bottom, and above it amphibians, reptiles, then, mammals and birds on the top branch of the tree. As the chambers and structure of the hearts modified one after another.

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
A gas-like mixture with no definite volume or shape that is made up of positively and negatively charged particles is a ____. Qu
sesenic [268]

Answer:

Gas

Explanation:

Gas has no definite shape and all.

6 0
3 years ago
Other questions:
  • A jogger in July produces large amounts of sweat. Due to this the kidneys change the rate of urine production. Why is this impor
    7·1 answer
  • The process of copying dna genetic information into the form of rna is called __________.
    14·1 answer
  • What are the phases of meiosis? ( full explanation and in order )
    7·1 answer
  • What is able to lower the activation energy in a chemical reaction
    14·1 answer
  • How can prokaryotic cells affect the health of the human body? Check all that apply.
    7·2 answers
  • Which type of genes when abnormally activated so that protein is always present and active can result in cancer
    7·1 answer
  • Question-
    10·2 answers
  • One strand in a segment of a gene has the base sequence TGCTTA. What would be the complementary sequence of nucleotides found on
    7·1 answer
  • What is 1+1<br><br> this is rlly hard bro someone plz help
    5·2 answers
  • A pathogenic RNA molecule is called a...<br> capsid<br> Virion<br> Virold<br> prion
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!