1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
8

I need super help on this . I’m doing a quiz right now .

Mathematics
1 answer:
torisob [31]3 years ago
5 0

Answer:

B) y = −1/2x + 9

Step-by-step explanation:

hope you do good on your quiz! good luck! :D

You might be interested in
Toby bought 8 hotdogs and 5 fries. It cost $34.00
ruslelena [56]

Answer:

Each hot dog = $3

Each french fry = $2

Step-by-step explanation:

First, lets define our variables:

x = Hotdog

y = fries

Next, you need to set up a cost equation for both Toby and Bernie:

8x + 5y = 34

2x + 6y = 18

Now, we need to isolate one of the variable:

2x + 6y = 18

2x = 18 - 6y

x = 9 - 3y

Next, we need to insert this equation back into the first equation (8x+5y = 34) to find the cost of y (fries):

8x +5y = 34

8 (9-3y) + 5y = 34

72 - 24y + 5y = 34

72 - 19y = 34

19y = 38

y or fries = $2

Finally, we need to find the cost of each hotdog by using the cost of fries ($2) in one of the formulas:

2x + 6y = 18

2x + 6(2) = 18

2x + 12 = 18

2x = 6

x or hotdog = $3

I hope this helps!

-TheBusinessMan

6 0
3 years ago
What is the exact value of cos 45° ?
Georgia [21]
Let the two sides of a right triangle be equal to one, which means that the hypotenuse is √2

Since cosa=adjacent side / hypotenuse

cos45=1/√2

We can rationalize the denominator by multiplying numerator and denominator by √2

√(2)/2

or if you prefer:  √(1/2)
3 0
3 years ago
Read 2 more answers
4. DE is the perpendicular bisector of JL. Which statement must be true?
ZanzabumX [31]

Since DE is the perpendicular bisector of JL.

The perpendicular bisector is a line that divides a line segment into two equal parts. It also makes a right angle with the line segment. Each point on the perpendicular bisector is the same distance from each of the endpoints of the original line segment.

Since, a perpendicular bisector is a line that divides a line segment into two equal parts.

So, JK=KL. (which is not given in the option)

Since ED is a perpendicular bisector. So, each point on ED is the same distance from the endpoints of line segment JL.

So, EJ=EL.

Therefore, Option 1 is the correct answer.

7 0
3 years ago
Read 2 more answers
Simplify x + 4 - 5x - 2
Blababa [14]

Answer:

-2(2x-1)

Step-by-step explanation:

x+4-5x-2

1) collect like like terms

-4x+2

2) factor out the -2

-2(2x-1)

3) that gives you the final answer of

-2(2x-1)

7 0
3 years ago
All the while the dog sat in the snow, its wolf-brush of a tail curled around warmly over its forefeet, its wolf-ears are forwar
slavikrds [6]

Answer:

The man is envious because he's jealous of the dog's fur. For he has natural covering and is kept warm because of it. The man has to wear several layers of clothing to be warm while the dog is warm enough with his fur/natural covering.

8 0
3 years ago
Other questions:
  • I need to how to work this out
    15·1 answer
  • The GRE is an entrance exam that most students are required to take upon entering graduate school. In 2014, the combined scores
    12·2 answers
  • You have two jobs. One job pays $7 per hour and the other pays $8.25 per hour. You worked 22 hours total last week and earned $1
    11·1 answer
  • What is the domain and range of y=6?
    5·2 answers
  • Which expression is equivalent to 7(xy)<br><br> 7x+y<br><br> 7x-y<br><br> x(7y)<br><br> xy/7
    9·2 answers
  • If F(x,y) = x^2sin(xy), find Fyx.
    6·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Um. i just need help with this! so if anyone knows help me plz &lt;3
    12·2 answers
  • Please help!! I need the answer and the explanation on how to do this
    6·1 answer
  • Round 0.0936 round to the nearest tenth
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!