1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
10

How does this behavior affect the survival of the eagle population? Someone please help:)

Biology
2 answers:
Hatshy [7]3 years ago
4 0

Answer:

A

Explanation:

I took the test recently

Lorico [155]3 years ago
3 0

Answer:

A. Provides a safe place for offspring to grow

Explanation:

You might be interested in
WILL GIVE BRAINLIEST ANSWER<br>please solve this problem
Sunny_sXe [5.5K]
Its just common sensde

8 0
3 years ago
Bacterial DNA is circular and arrayed in a region of the cell known as what? Answers: nucleus, nuceloid, mitochondria, Golgi app
Oksi-84 [34.3K]
I believe the answer is nuceloid 
6 0
3 years ago
Read 2 more answers
1) if new individuals with different colors migrated into your ecosystem, what would the effect be on the community if the ecosy
prohojiy [21]
Since there environment changed there will be new predators.
 pls give me brainliest

8 0
3 years ago
Whats the difference from the first and second law of thermodynamics
Aleks [24]

Answer:

Explanation:

the first law is the law of conservation of energy which basically means energy can't be created or destroyed in an isolated system.

the second law is that the entropy always increases in the isolated system. entropy is the measurement of the units thermal energy per unit temp.

7 0
3 years ago
2 Lin sulks during the first week of rehearsals because she is – A tired from working on the set B bored with her duties as a de
RUDIKE [14]

Answer:

skull tropper

Explanation:

I got it from the guy from fortnite

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why is the sky blue? wrong answers only
    14·2 answers
  • Why is my life so pointless?
    11·2 answers
  • Soil reaction is _______. a. the measure of the acidity or alkalinity of soil b. the highest amount of cations soil can absorb c
    13·2 answers
  • When a cell gains water, what happens to its size and weight?
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Compare chromosome behaviors during mitosis and meiosis.
    7·1 answer
  • Viruses, although not considered to be alive, attack host cells and cause disease. The attack of a host cell is necessary for th
    6·2 answers
  • An antibiotic is a type of medication that cures infectious diseases. Why does the word antibiotic suggest that these medication
    7·2 answers
  • Which of the following are NOT correct based on Darwin's theory of evolution?
    11·1 answer
  • Newton's Law Song Verse
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!