1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igomit [66]
3 years ago
12

Convert 30 ft to cm .......................................

Biology
1 answer:
Anon25 [30]3 years ago
6 0
914.4 cm……………………………..
You might be interested in
The tree of life is made up of which domains?
Bingel [31]
Domain bacteria, Domain Archaea and Domain Eucarya
3 0
3 years ago
Read 2 more answers
Question 13
zysi [14]

Answer:

contain only prokaryotic organism.

6 0
3 years ago
Which pattern of dispersion does the global human population have?
Mademuasel [1]

Humans increasingly dominate the landscape, a force largely driven by population growth and dispersion. In the United States and worldwide, rural landscapes in many places are transforming to exurban and eventually public uses.

5 0
3 years ago
Enumerati caracteristicile care fac din Rezervatia Delta Dunarii un unicat ecologic.
katrin [286]

1. Are peste 300 de specii de pasari

2.Este singura rezervatie naturala unde traieste cainele enot

3. Sunt specii de pesti care depun icre negre


5 0
3 years ago
Which of these organisms can make glucose?
drek231 [11]

Poison Ivy. They are plants and can make their own food aka Glucose.

6 0
3 years ago
Other questions:
  • 43. If the chemical maleic anhydride reacts with water to form a strong acid, which of the following would be the best method fo
    8·1 answer
  • What safeguards must society adopt to handle the rapid advances in biotechnology?
    9·1 answer
  • Which structures are responsible for the movement of white blood cells to engulf infectious bacteria?
    13·1 answer
  • What are food enzymes?
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • How are these genes related?
    7·1 answer
  • Most respiration occours in organels is?
    12·1 answer
  • What are living things
    12·2 answers
  • Write about important steps in the process of water purification in a water treatment plant​
    6·1 answer
  • What are harmones ? why are they produced​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!