1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natali 33 [55]
3 years ago
12

How are the Hawaiian honeycreepers an example of adaptive radiation?

Biology
1 answer:
tatuchka [14]3 years ago
5 0

Answer: In adaptive radiation, many different species evolve from a single ancestor species. Each new species evolves to exploit a different niche, such as food source. In the example above, Hawaiian honeycreepers evolved a range of bill forms in response to available food sources on the Hawaiian archipelago. The honeycreepers dispersed from one founder species, and evolved in response to natural selection based on different food sources in their isolated habitats provided by water. Seed-eating birds evolved thick, short beaks.

You might be interested in
Which process makes it possible for all the major organs of the body to be formed by week 10 of human
yKpoI14uk [10]

Answer:

Differentiation

Explanation:

The process that makes it possible for all of the body's major organs to be formed by the tenth week of gestation is known as differentiation.

3 0
3 years ago
Read 2 more answers
Which of the following would cause an error in DNA replication
alukav5142 [94]

I don't see any options. But, an error can occur if a DNA polymerase inserts an incorrect base.

4 0
3 years ago
_____ includes crude comments or sexual jokes and behaviors that convey hostility toward a particular gender.
Sati [7]

Answer:

Gender Harrassment

Explanation:

This could also be called sexism.

7 0
4 years ago
Are physical characteristics of an organism not genetically passed down?
Tomtit [17]
That is false. Physical characteristics of an organism are genetically passed down.

—Evidence—

A characteristic that an organism can pass on to its offspring through its genes.

The set of information that controls a trait; a segment of DNA on a chromosone that codes for a specific trait.

Heredity is the biological process responsible for passing on physical traits from one generation to another.
6 0
3 years ago
in order to keep a resting membrane potential, the active transport of the sodium and potassium pump must function to keep:
krek1111 [17]

The active transport of the sodium and potassium pump must work to maintain: A high concentration of sodium outside the cell and a high concentration of potassium inside the cytosol in order to maintain a resting membrane potential.

Active transport in cellular biology refers to the movement of molecules or ions across a cell membrane against the concentration gradient from a location of lower concentration to a region of higher concentration. Cellular energy is needed for active transport to achieve this movement.

The electrical potential differential across the plasma membrane of a cell during its non-excited condition is referred to as the resting membrane potential of the cell. The value of the electrical potential difference inside a cell compared to the extracellular environment is often used to indicate the difference across a cell membrane.

To learn more about Active transport click here,

brainly.com/question/12133248

#SPJ4

5 0
1 year ago
Other questions:
  • A dark brown/black layer surrounding most of the eye which prevents light scatter within
    10·1 answer
  • ______ properties can be observed only when the substance in a sample of matter are changing into different substances
    5·2 answers
  • Please answer this !! Will mark Brainliest answer !!
    6·1 answer
  • Using the nonexperimental method, a researcher collects data on exercise and anxiety from a number of people and finds that exer
    14·2 answers
  • Which part of a lab report would most likely show a line graph of the data collected?
    7·2 answers
  • FRREEEEEE
    14·2 answers
  • The characteristic of the human immunodeficiency virus (HIV) that makes it different from other RNA viruses is that it _________
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which example is a variant of a gene?
    12·1 answer
  • Quickly answer!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!