1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
2 years ago
6

PLEASE HELP! - Describe why carbon, hydrogen, oxygen, nitrogen, & other elements can combine. Describe the results of these

combinations.
Biology
1 answer:
lbvjy [14]2 years ago
7 0

Answer:

Carbon, Oxygen, Hydrogen And Nitrogen - Have In Common? They All Have The Same Number Of Valence Electrons. They All Have Unpaired Electrons In Their Valence Shells. They Are Elements Produced Only In Living Cells.

You might be interested in
What is a host cell?
Fed [463]
A host cell is an animal or plant
4 0
3 years ago
Read 2 more answers
1. Cuando el extremo de un objeto de calienta y este transmite partícula a partícula a todo el objeto
yanalaym [24]

El mecanismo por el cual el calor se transfiere de un objeto a otro a través de colisiones de partículas se conoce como conducción. En conducción, no hay transferencia neta de material físico entre los objetos.

4 0
3 years ago
Why is it impossible for male calico cats to exist
Kisachek [45]

Answer:

genetics

Explanation:

calico cats must also inherit a gene unrelated to the X and Y chromosomes that codes for white fur. Because male cats have one X chromosome with code for black or orange and one Y chromosome with no color genes, they cannot technically be calico. About one in every 3,000 calico cats is born a male, and, unfortunately, don't live as long as female calicos due to their genetic abnormalities. XXY Syndrome renders male calicos sterile and can be the root cause of many other health problems

8 0
3 years ago
In general, what determines
meriva
C: The arrangement and movement of the particles in the substance. Solid particles vibrate and are compact. Liquid slide past each other and are close together. Gas particles are fast moving and very spread out.
7 0
2 years ago
Two cells have the same volume and similar shape, but one has microvilli extending from its cell membrane while the other does n
Naily [24]

be slower at absorbing nutrients than the other cell

Explanation:

The cell without the microvilli will be expected to have as slower absorption rate of nutrient than the other cell.

  • Microvilli are finger-like projections from the surface of the cell.
  • The structure has a large surface area to volume ratio which allows for nutrient to be absorbed easily.
  • These structures are very important during the absorption of digested food in cells.

Cells without this structure will not absorb food faster.

Learn more:

Microvilli brainly.com/question/11115604

#learnwithBrainly

3 0
3 years ago
Other questions:
  • Why are sex-linked traits more common in males than in females?
    11·1 answer
  • Which cyclic process is responsible for sexual reproduction of a diploid sporophyte
    14·1 answer
  • A geneticist discovers an obese mouse in his laboratory colony. He breeds this obese mouse with a normal mouse. All the F1 mice
    12·1 answer
  • 1-5 fill in the blanks
    12·2 answers
  • The National Weather Service has issued three tornado watches so far this month.
    8·1 answer
  • A student collected the above data for this experiment. What error did he make? Explain. Mass of the Graduated Cylinder
    7·2 answers
  • What does gravity mapping show?
    7·2 answers
  • Why is it important not to misuse or overuse antibiotics? Explain your answer
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A 2016 experiment by researchers at UC Irvine established a link between autonomic nervous system activity during sleep and memo
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!