Biological diversity is the variety of species in a given area. If a new species is added there are more species and therefore greater biological diversity and if one goes extinct there are less species and therefore less biological diversity.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
A) tortoiseshell female; black male
Explanation:
Females have two X chromosomes and males have an X and a Y chromosome.
<u>The possible genotypes and phenotypes are</u>:
- XᵒXᵒ: black female
- XᵒY: black male
- XᴼXᴼ: orange female
- XᴼY: orange male
- XᵒXᴼ: tortoiseshell female
<u>Cross of a black female and an orange male</u>
<h3>XᵒXᵒ x XᴼY</h3>
The female only produces Xᵒ gametes. The male produces Xᴼ and Y.
The possible offspring therefore is: XᵒXᴼ (tortoiseshell females) and XᵒY (black males). The answer is A.
Concentration gradient across the membrane. Proteins in the membrane allow specific molecules through, passively.