I’m not entirely sure what is being asked here, but the Tigris and Euphrates rivers is the only place in Egypt (besides the nile delta) with non-arid ground. That’s why most people live around there:
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:Espero te sirva
Explanation:La subducción es el proceso de hundimiento de una placa litosférica bajo el borde de otra placa, formándose los llamados límites convergentes entre placas. La placa subducida, la que se hunde, suele estar formada por corteza oceánica, más delgada y densa que la continental. La subducción ocurre a lo largo de amplias zonas de subducción que en el presente se concentran especialmente en el entorno del océano Pacífico, en el llamado cinturón de fuego del Pacífico, pero también hay zonas de subducción en partes del mar Mediterráneo, las Antillas, las Antillas del Sur y la costa índica de Indonesia.
Nigeria is a country in West Africa.
Petroleum is a very important part of our day to day life now. We use it almost every day and it has helped emerge the world of vehicles.
<h3>Remains of sea organism</h3>
The remains of ancient marine organisms and sea organisms are used to extract crude oil or petroleum which serve as a fuel for vehicles. These organisms are ancient marine plants, algae and bacteria.
Therefore it can be concluded that the type of fossil fuel in which the remains of sea organisms are converted to is petroleum or crude oil.
Learn more about fossil fuel here:
brainly.com/question/2029072
