Similar organisms that can reproduce by interbreeding belong to the same species.
The heat from hot liquid can make the cup it’s in hot. When you make some food in a pot with boiling water and stick a metal spoon/fork into the pot to move the food around the boiling water then makes the spoon/fork hot.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The correct option is D.
Antibiotic resistant is said to occur, when a particular antibiotic has lost its capacity to effectively eliminate or control the growth of a particular type of bacteria. In this case, the bacteria continues to grow and multiply in the present of the antibiotic drug. Antibiotic resistant usually occur when a bacteria has develop a variation that makes it possible for it to inactivate the antibiotic drug that is used against it. A bacteria that is formerly susceptible to a particular antibiotic may later become resistant to the same drug by developing variations that inactivate the antibiotic drug that is administer to destroy it.
