1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
11

4. When a Na atom, loses one electron, it gets a charge of _______. -1 +1

Biology
2 answers:
Kruka [31]3 years ago
8 0

Answer:

+1

Explanation:

because when an atom loses an electron it gains

Nana76 [90]3 years ago
5 0
+1 is the answer g yccuucyxrTzjvvhfxgcjbyxtzrEdgcvhkbknhvycgx
You might be interested in
Select All That Apply.
Lera25 [3.4K]
Not sure if you still need the answer but its number Three, they are the decomposers in many ecosystems 
3 0
3 years ago
Read 2 more answers
The type of learning that occurs when a stimulus produces a particular response because it’s associated with a positive or negat
Alik [6]
Science subject in school
8 0
3 years ago
Read 2 more answers
Which layer of Earth has the most mass? A*the crust B the mantle C the inner core D the outer core
Tanya [424]

Answer: the mantle B

Explanation: Largest layer resulting in biggest mass.

8 0
3 years ago
Read 2 more answers
How can humans reduce the amount of endangered and extinct species?
Andrews [41]
There are many ways humans can reduce the amount of endangered and extinct species. However, I would say by reducing pollution and logging/mining. Nearly 318 species have become extinct due to pollution. The reduction of carbon emissions would be a good way to curb the amount of pollution produced by humans.
4 0
2 years ago
What percentage of offspring will have pink flowers
marshall27 [118]

Answer:

50%

Explanation:

The pink flower donates the r allele and produces pink flowers in 50% of the offspring.

5 0
2 years ago
Read 2 more answers
Other questions:
  • The coefficients in a balanced chemical equation always can express the ratio of
    12·1 answer
  • All cells come from preexisting bones<br><br><br><br> true or false?
    11·2 answers
  • 24) During the process of _______________, the genetic message from DNA is transformed into mRNA.
    12·2 answers
  • A client who developed gestational diabetes mellitus during the pregnancy has just been admitted in the labor and delivery unit.
    10·1 answer
  • To determine whether a bloodstain is of human or animal origin, the serologist will perform
    10·1 answer
  • Which of the following carries messages to parts of the body
    7·2 answers
  • Vessels that carry blood from the muscles back to the heart are called
    11·2 answers
  • Oxygen and nutrients are transported around an animals body by the
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Easy 15 points! Please put an explanation
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!