1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
3 years ago
11

1 Point

Biology
1 answer:
____ [38]3 years ago
8 0

During Prophase chromosomes condense, and mitotic spindle form, chromosomes are copied, and the nuclear membrane disappears, spindle fibres pull the sister chromatids apart.

Explanation:

Prophase is divided into 2 sub-phases as early Prophase and late prophase.

Early Prophase:

In early prophase distinct thick chromosome like structures, Centrioles move to the opposite poles and, nuclear membrane disappears

By late prophase:

Astral rays and spindle fibres are formed. Spindle fibres attach to the chromosome. Contractions occur in the attachment and sister chromatids are pull apart towards the equator.

Metaphase will follow the prophase.

You might be interested in
An olympic runner prepares to run a 100 meter race. Which of the body systems listed will probably be LEAST involved in the 100
tekilochka [14]
The answer your looking for is c hope it helps 
and #rateme 
5 0
3 years ago
Read 2 more answers
In a nucleosome, the DNA is wrapped around
Blababa [14]

Answer:

a. histones. is the correct answer.

Explanation:

In a nucleosome, the DNA is wrapped around eight histones proteins to create strong loops termed nucleosome.

A nucleosome is the structural subunit of the chromatin.

Chromatin is a fiber polymer of double-stranded DNA which is composed up of a nucleosome core. The nucleosome core is made of histone proteins

Each nucleosome is composed of DNA enclosed around eight histone proteins which are called histone octamer.

3 0
3 years ago
How do the sizes of your two populations affect each other? (or do they?) does either one show population cycles? 2. did either
PIT_PIT [208]
That’s a good question I️ don’t know lol
8 0
3 years ago
Which of the following is the best example of a way human lifestyles affect environmental systems?
Vlad [161]
The best and most correct answer among the choices provided by your question is the first choice or letter A.

Agriculture causes water pollution when fertilizers and pesticides flow into lakes and rivers is the best example of a way human lifestyles affect environmental systems.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
5 0
3 years ago
Read 2 more answers
What is the probability of having a male (XY) or female (XX)
Andrew [12]

There is a 50% chance of a female and a 50% chance of a male

Hope that helps :)

6 0
3 years ago
Other questions:
  • _____ is an essential lung-coating substance that keeps air sacs from collapsing.
    11·1 answer
  • A hydra is an aquatic organism that lives in fresh water. During reproduction an outgrowth begins to form on the parent. The out
    5·1 answer
  • Which one of the following most closely approximates the number of replicons in a human focus of replication?a. 1b. 50c. 100d. 3
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What causes the motion of particles
    9·1 answer
  • As energy moves through an ecosystem,
    8·2 answers
  • The heart is made up of the left and right ________________ and the left and right _______________________________.
    10·1 answer
  • How do our social groups and social interactions impact our behavior?
    6·2 answers
  • It is possible to determine a person’s exact date of birth from their bones.
    11·1 answer
  • What is the purpose of the part of the male reproductive system that is
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!