Answer: historical allusion
Explanation:
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
Choose a different word from those you selected to study in this unit and explain where you have heard it used previously. Write the sentence you heard with the vocabulary word in it and include who used the word and when it was used. Use proper grammar and spelling.
The word I chose is inure.
"The bad weather that passed through the state caused tomatoes, flooding, and hailstorms"
Yes the question should have a comma
Explanation:
the rapid increase of population ,technology , political changes and fame