1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
10

Can omega 3 be artificially produced?

Biology
2 answers:
exis [7]3 years ago
6 0

Answer:

in theory yes

Explanation:

densk [106]3 years ago
6 0

<u>Your Answer:</u>

Hello there My name is Tobie and I would be more than glad to help!After a thorough examination Your answer should be <u>No</u> Omega 3 or  (omega-3 fats and n-3 fats) Cannot be artificially produced.

<u>Here's why.</u>

The reason Omega 3 cannot be created  is because These are essential fats.The body can make Omega 3 but it cannot be made from scratch again also because they are essential fats .Ways the body can create Omega 3 is by eating foods that already contain Omega 3.Here are some foods that contain Omega 3 !

  1. Fish,
  2. vegetable
  3. oils,
  4. nuts,
  5. flax
  6. seeds,
  7. flaxseed
  8. oil,
  9. and leafy vegetables.

<u>FAQS</u>

<u>Do avocados have Omega 3?</u>

Avocados contain vitamins C E K and B6 some other nutrients as well to they also contain omega-3 fatty acids. But most of the calories in a avocado come from fat.

<u>Why Omega 3 is bad for you?</u>

Yes this plays a significant role in our diet by helping us improve our cardiovascular health having but  too much of it can lead to having  high blood sugar and a increased risk of bleeding.

<u>Hope this helps!</u>

<em>                                                                                      -Tobie the dog <3</em>

You might be interested in
two students are discussing natural selection in bacteria and how it can relate to antibiotic resistance in bacteria
shutvik [7]

Answer:

yes

Explanation:

some the bacteria are resistance to antibiotics due to mutation.

4 0
3 years ago
If one is constructing a phylogeny of reptiles using DNA sequence data, which taxon (birds, mammals, amphibians or fish) might b
neonofarm [45]

Answer: If one is constructing a phylogeny of reptiles using DNA sequence data of birds, mammals, amphibians or fish, the suitable outgroup to be used are mammals due to the time of divergence from other group of organisms.

Explanation: Phylogeny is used to determine evolutionary relationship between items or organisms. A phylogenetic tree is a graphical illustration of phylogenetic relationship. In phylogeny, an outgroup represent an organism that is more distantly related to other group of organisms.

In a phylogenetic tree, outgroup stands alone. It shows that the time of divergence of that particular organism is far from other group of organisms. Outgroup is used to root a tree and sometimes represent a group that is more ancestral on a tree.

It should be noted that differences in the DNA sequences of the organisms under consideration will determine which organism will serve as the outgroup.

3 0
3 years ago
Which sequence of RNA transcribed from the base sequence of DNA is ATA CCG ATC GAT
HACTEHA [7]

Answer:

a

Explanation:

this image shows what each letter changes to.

6 0
3 years ago
Read 2 more answers
What is smooth er resonibale for?
timurjin [86]
The smooth endoplasmic reticulum functions in many metabolic processes. It synthesizes lipids, phospholipids as in plasma membranes, and steroids.
7 0
2 years ago
SOMEONE PLZ HELP ASAP
ivann1987 [24]

Answer:

A

Explanation:

Golgi apparatus, a membrane-bound organelle with cisternae, delivers proteins and lipids from the endoplasmic reticulum to where they are needed- such as for secretion outside the cell. Fused vesicles with proteins/lipids that pinch off from the <em>trans</em> end of the ER fuse with the <em>cis</em> end of the Golgi apparatus delivering the ‘cargo’. The proteins/lipids are then given post-translation modified and ‘marked’ for different deliveries. At the trans end of the Golgi apparatus, the vesicles pinch-off with the modified proteins and transported to their destination.

8 0
2 years ago
Other questions:
  • Convert 0.14 kilograms to grams.<br>grams​
    7·2 answers
  • Which of the following roots mean the same thing?A. arthr/o and angi/oB. cardi/o and vascul/oC. enter/o and gastr/oD. hem/o and
    12·1 answer
  • How does the digestive system facilitate excretion of wastes?
    13·1 answer
  • Name 3 things that affect longshore currents
    8·1 answer
  • Which one of the following statements about endosymbiosis and the origin of the eukaryotic cell is FALSE?
    14·1 answer
  • Where is the diaphragm located? between the ribs inside the lungs below the lungs above the ribs
    5·2 answers
  • Question 7 (1 point)
    7·1 answer
  • In cats, coat color is an X-linked trait with incomplete dominance. Yellow coat is caused by the allele XT and black coat by the
    12·1 answer
  • What is the relationship between the two parts of the nervous system?
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!