Answer:
The correct answer is B. quartering-toward
Explanation:
Shot angle is important to do a successful hunt. It is the angle that denotes the position of animals concerning to he hunter. The best shot angle is the broad shot angle for big game animals.
Quartering towards is the marginal shot angle which can result in the ruining of edible meat in large amounts. The risk of failing in making a clean and quick kill is also low in this angle because bones can protect the vital organs of the animal at this angle and the animal can change its position quickly as it can see the action of hunter.
Answer:
As well as producing hormones, vaccines and other drugs genetic engineering has the potential to cure genetic diseases through gene therapy. ... Genetic engineering: Process of inserting new genetic information into existing cells in order to modify a specific organism for the purpose of changing its characteristics.
Explanation:
Answer:
The correct answer is : option A. emotional arousal in the amygdala activates memory consolidation in the hippocampus.
Explanation:
Hippocampus is the part of the brain known for the consolidation of the memories to short time to long term memories based on their emotional relevance.
Amygdala is the part of the brain that is responsible for emotional arousal or forming emotion which is later activates the hippocampus to consolidate this memory. Memory with the emotional aspects retained for long term than boring or humdrum experiences due to the reason mentioned above.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
it is called tympanostomy tubes. they also help to equalize pressure
