1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
3 years ago
15

What is the genotype and phenotype for A male hemophiliac with a woman pure for normal clotting.

Biology
1 answer:
erik [133]3 years ago
3 0

Answer:

Male=XhY and woman=XHXH

You might be interested in
Ming’s mother served him fried eggs for breakfast. After seeing the eggs, he noticed that they closely resembled a stage in cell
Rainbow [258]

I think this is correct!!!

5 0
4 years ago
Read 2 more answers
Someone help me pls :/
MArishka [77]

Explanation:

All the human causes of global environmental change happen through a ... Three case studies illustrate the various ways human actions can contribute to ... It is possible to make such a division in numerous ways.

8 0
3 years ago
H
Anit [1.1K]

Answer:

Law of dominance

Explanation:

It just it

3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The DNA of humans and mice is almost 92% similar. This similarity indicates that
strojnjashka [21]

Answer:

This similarity indicates that mice share a common ancestor with humans. Mice have a tail, while humans have a tailbone

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which feedback mechanism is used to regulate blood glucose?
    8·1 answer
  • the inability of an organism to produce certain proteins can occur when an organism is lacking am enzyme needed to combine
    7·1 answer
  • Ben was studying conjugation in prokaryotes. He learned that prokaryotes attach themselves to each other and exchange genetic in
    6·1 answer
  • True or false cytokinesis is the process of nuclear division; mitosis is the process of cytoplasma and cell membrane division? (
    13·1 answer
  • (( EARTH ScIENCE ))
    11·1 answer
  • Which of these would be LEAST LIKELY to affect the rate of a reaction?
    5·1 answer
  • How does carbon move from the atmosphere into plants
    5·1 answer
  • Question 2 pls answer :P. this is 20 point's
    7·1 answer
  • An example of something that stores chemical energy is
    14·2 answers
  • What characteristic of life can you live without out of the 10 main ones
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!