1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
15

Which of the following demonstrates

Biology
1 answer:
Korvikt [17]3 years ago
5 0

Answer:

D

Explanation:

Asexual reproduction results in less diversity among offspring. Sexual reproduction causes genetic variation because the sperm and egg that are produced contain different combinations of genes than the parent organisms. however, asexual offspring are copies of the parents.

You might be interested in
Differentiate between dominant and recessive traits
Diano4ka-milaya [45]
Dominant trait<span> definition. In genetics, a </span>trait<span> that will appear in the offspring if one of the parents contributes it. (Compare recessive </span>trait.) Note: In humans, dark hair is a dominant trait; if one parent contributes a gene for dark hair and the other contributes a gene for light hair, the child will have dark hair ...Recessive traits<span> can be carried in a person's genes without appearing in that person. For example, a dark-haired person may have one gene for dark hair, which is a dominant </span>trait<span>, and one gene for light hair, which is </span>recessive<span>.
</span>

5 0
3 years ago
Read 2 more answers
g If I see a decreased response after administration of repeated doses of a drug I might suspect that the cell has a) Up regulat
alexandr1967 [171]

Answer:

More than one of the above

Explanation:

I strongly recommend sticking with the prescribed dosage of a drug.

A drug works by binding itself to the receptor site of a cell or tissue by non-covalent interactions.

Repeated doses of the same drug however may make the drug start behaving as an inverse agonist by blocking (instead of binding) the receptor site of the cell thus inducing a reduced response instead of an increased response to the drug.  

3 0
3 years ago
What is a polyp???????????????????????
andreev551 [17]

Abnormal tissue growth on a mucous membrane.

8 0
3 years ago
Read 2 more answers
What are the reactants of the cellular respiration reaction?
Shtirlitz [24]

Answer:

I think oxygen and gulcose but i am not sure

Explanation:

5 0
3 years ago
When an f1 plant undergoes meiosis, what gamete types will it produce, and in what proportions??
Natalija [7]
Using the Mendel's law of segregation, the correct answer of the given question above would be 1/2 Y, 1/2 y. When an f1 plant undergoes meiosis, the gamete types that it will produce and in what proportions is <span>1/2 Y, 1/2 y. Hope this is the answer that you are looking for. </span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why do blood vessels and lymph vessels have valves?
    15·1 answer
  • Leaves uses_,_and_to make food for the plant​
    15·1 answer
  • Energy-producing organelles are the _____.?
    9·1 answer
  • Small, accessory chromosomes found in bacteria that are useful in recombinant dna procedures are called
    13·1 answer
  • This is the liquid. Within living cells. . It is important because it helps materials to spread through the cell
    12·1 answer
  • How do scientist work
    8·2 answers
  • PLEASE HELP QUICK!!!!!!! WILL GIVE BRAINIEST!!!!!!!!
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Any one please help me on this one please
    10·1 answer
  • What is the probability for an average star to supernova?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!