1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
3 years ago
5

Describe two adaptations of the saguaro cactus for water conservation

Biology
1 answer:
zubka84 [21]3 years ago
5 0
Two adaptations of a saguaro cactus in order to store water are as following: 
1. large stems can store water.
2.thick waxy skin in order to reduce water loss through pores.
You might be interested in
Which of the following describes a benefit of membership in research community?
sdas [7]
 Knowledge and valuable resources are shared among scientists.


3 0
3 years ago
Read 2 more answers
10 POINTS
tatiyna

Answer:

The answer is C

Explanation:

8 0
3 years ago
Embryonic stem cells have shown promise when used to treat certain diseases. Despite this, there are many people opposed to stem
Advocard [28]
B) Embryonic stem cell research requires the use of human embryos. Its an unethical dilemma.
3 0
3 years ago
1. Predict Suppose a fungus killed a species of tree in a forest community. What might happen to the
Elodia [21]

Answer:

<u>The woodpeckers wouldn't have homes/shelters to keep themselves safe so they would slowly die out.</u>

Answer 2:

I'm pretty sure you can also say, <u>they would have to adapt to living in a new species of tree</u>

<u></u>

I hope this helped

7 0
3 years ago
If the eyepiece has a magnification of 10x, what would be the total magnification of an image if you were using the lower power
motikmotik
<span>To figure the total magnification of an image that you are viewing through the microscope is really quite simple. To get the total magnification take the power of the objective (4X, 10X, 40x) and multiply by the power of the eyepiece, usually 10X.</span>
3 0
3 years ago
Other questions:
  • What is genetic modified food
    7·2 answers
  • What type of biomolecule (lipid, protein, nucleic acid, or carbohydrate) is chlorophyll?
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A train accelerated at a constant speed of 235m/s for 8 seconds whats the acceleration during this period?
    10·1 answer
  • Which describes the correct paring of DNA?
    12·1 answer
  • Which of the following is the largest of the bundles of tracts that connect the cerebellum to other parts of the brain?
    11·1 answer
  • What additional levels of organization are in multicellular organisms
    14·1 answer
  • Somebody help me with these 4 questions please
    5·1 answer
  • Write a parag<br>raph about importance of trees<br><br><br>​
    14·1 answer
  • Please help me with a and b
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!