1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
12

Im confused its more science but yah oof

Biology
2 answers:
Assoli18 [71]3 years ago
6 0
Rapidly rapidly rapidly
Musya8 [376]3 years ago
6 0
Rapidly is the correct answer.
You might be interested in
How carbon is absorbed?
Aleksandr [31]
Through the atmosphere and through <span>oceanic conveyer belts that act as physical pumps</span>
5 0
3 years ago
6) What term describes an educated guess that needs to be tested by
faltersainse [42]
Theories are educated guests that are tested by experiments
4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Could you put in order please i will give u 30 points x
SSSSS [86.1K]
I believe the order is...

Producers
Primary Consumers
Secondary Consumers
Tertiary Consumers

I hope this helps!
8 0
3 years ago
Read 2 more answers
What are some limiting factors that the orca population experienced while in<br> captivity?
anastassius [24]

Some limiting factors that the Orca population experienced while in captivity include food and dissolved oxygen.

<h3>What is Limiting factor?</h3>

This refers to any variable or factor in the environment which limits the population expansion of a given species.

In the case of Orca they are present in the sea and need food and dissolved oxygen to survive which is why it acts as a limiting factor due to their absence causing a decline in population.


Read more about Limiting factor here brainly.com/question/1375274

#SPJ1

5 0
1 year ago
Other questions:
  • What are the two categories of observations?
    8·2 answers
  • When completing the water properties lab, which property of water was reasonable for the water molecules sticking to the penny?
    13·1 answer
  • Why is are invasive species a problem?
    5·1 answer
  • What factors can change the dissolving rate of solution ?
    6·1 answer
  • The branching "tree of life" analogy:
    13·1 answer
  • The conchae __________.
    12·1 answer
  • Determine whether the statements about DNA are true or false.
    8·1 answer
  • A large forested area is fragmented into small forest tracts separated by agricultural areas. This change will most likely lead
    12·1 answer
  • The growth of plant seedlings is usually
    14·1 answer
  • *PLEASE ANSWER ASAP*
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!