Z = 24 because 180 - 48 = 132 and that divided by 2 = 66 then do 180 - ( 90 + 66 ) = 24!
Answer:
xylem cell and phloem cell
Yes both occur in mitocondria.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Thats the answer for your question