Answer:
Describes ecosystem homeostasis
Explanation:
The molecular biology technique of reverse genetics can be useful for determining the function of a gene.
<h3>What is reverse genetics?</h3>
Reverse genetics is method use in molecular biology to determine gene function in an organism
The procedure in reverse genetics involves modifying or certain nucleotide sequences in the DNA coding for a functional gene and then observing changes to the phenotype of the organism brought about by the modifications.
Therefore, reverse genetics can be useful for determining the function of a gene.
Learn more about reverse genetics at: brainly.com/question/9896589
Answer:
They grow more slowly, reproduce less, and populations decline.
Explanation:
brainliest plzzzzzzzzzzzzzzzzzzzzzzz
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The correct answer is -Biosocial perspective.
Explanation:
In the last few years, the research and thinking on biosocial perspectives on the family come in light. The biosocial perspective on the family is characterized by concepts or laws related to various psychological factors to evolution, genetics, and physiology.
Three major developments that are contributed in this perspective are findings of proximate biological interplay, advances in evolutionary thinking and alteration in the field of studies related t the family.
Thus, the correct answer is - the biosocial perspective.
