1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivolga24 [154]
3 years ago
10

Giving 50 pts answer correctly for the points Vertebrates share many physical characteristics. All vertebrates

Biology
1 answer:
drek231 [11]3 years ago
7 0

Answer:

Question 1: have an internal skeleton that includes a backbone or spinal column.

Question 2: You didn't upload the picture.

Question 3: Mammal

Question 4: A segmented worm

Question 5: Amphibians have four limbs.

Question 6: Mollusks

Question 7: Arthropod

Question 8: All of the above

Question 9: invertebrates, echinoderms

Can I get a brainliest?

You might be interested in
An icy, rocky object that has<br> a tail and orbits the Sun
Rus_ich [418]
Must be a comet I believe 
8 0
3 years ago
Read 2 more answers
What is the primary mechanism which causes surface currents
Nikolay [14]

Answer:

Surface currents in the ocean are driven by global wind systems that are fueled by energy from the sun. Patterns of surface currents are determined by wind direction, Coriolis forces from the Earth's rotation, and the position of landforms that interact with the currents.

6 0
3 years ago
What is the differences between cellular respiration and respiration
3241004551 [841]

Think of respiration as ‘cellular respiration,’ which is the process by which the body extracts energy from glucose molecules. Breathing is the mechanism of the lungs that brings oxygen into the body and expels carbon dioxide

Respiration is a vital way for the cells of plants and animals to obtain and utilize energy. Without this energy, cells in the bodies of plants and animals would fail to function and will eventually break down and die. The breaking down of sugar into energy and storing it in ATP is the key to the survival of living organisms.

The formation of ATP involves two different processes, cellular respiration and fermentation. The reactions to these processes are controlled by enzymes and involve the loss and gain of electrons.

Cellular respiration takes place in the cells of organisms using metabolic reactions and processes to convert biochemical energy from the nutrients they absorbed into ATP or adenosine triphosphate and to release waste products.

The energy derived from nutrients like sugar, amino and fatty acids, an electron acceptor which can be oxygen (used by aerobic organisms) or other inorganic donors like sulfur, metal ions, methane, or hydrogen (used by anaerobic organisms) are stored in ATP and used for biosynthesis, locomotion and to transport molecules in cell membranes.

Cellular respiration can be aerobic or anaerobic. Aerobic respiration requires oxygen to generate ATP and plants and animals use this in utilizing the energy they received.

3 0
3 years ago
How does pH change protein structure?
serg [7]
PH changes protein structure if the pH level is below seven which is acidic and or above seven which is basic. The best condition for the enzyme to work is the pH of seven this is where the protein carries out its function and is not denatured. It fits into the enzyme
6 0
3 years ago
What genetic variation has occurred in the picture below where a black bunny and a white bunny have an offspring that shows both
Softa [21]
<h2>Answer:</h2>

The correct answer is B which is codominance.

<h3>Explanation:</h3>
  • One allele of a gene for a trait can be dominant or recessive according to the simple genetic phenomenon.
  • But there are some exceptions Like both allele can express them dominantly producing an offspring having both forms of that trait.
  • While in incomplete dominance, dominant allele is unable to expresses itself completely and a phenotype between dominant and recessive trait is produced.
  • Hence in the problem, offspring have both colors of fur from two parents, so it is codominance.
3 0
3 years ago
Other questions:
  • Why does it make sense that muscle cells would be the best adapted to carry out fermentation?
    9·1 answer
  • Explain why glucose consumption must increase in hypoxic tissues to provide the same amount of ATP that could be produced from g
    15·1 answer
  • Innate immunity includes all of the following EXCEPT
    6·1 answer
  • Why is sexual reproduction more advantageous than cloning
    6·2 answers
  • Which of the following explains how cells are regulated in their growth and reproduction?
    14·1 answer
  • How is a model of the carbon cycle different from the actual cycling of carbon in an ecosystem?
    14·2 answers
  • What would most likely happen if the number of shrimp decreased
    11·2 answers
  • From the laboratory exercise, match the plant group to the plant examined. [8 pt] Miniature Parlor Palm Coleus Blue Rabbit’s Foo
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is meant by this statement?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!