1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
3 years ago
14

Pls help me asap for brainlest :)

Biology
1 answer:
professor190 [17]3 years ago
5 0

Answer:

The correct answer would be A

Explanation:

The picture shows the PMAT process Prophase occurs first the chromosomes become visible as paired chromatids and the nuclear envelope disappears.

Then the Metaphase. The way you can remeber that s by looking at the first letter which is M. Stands for Midlle. So you can say the chromososmes are in the middle together. Now Anaphase. The way you can remember that is by looking at A meaning Away. You can think of that as the chromosomes being pulled away from each other moving opposite ways. Now last is Telophase. That when they make two nuclei. When they are divided into 2 there are not nucleus anymore but nuclei.

Hope this helps :)

You might be interested in
Define the term adaptation​
aliya0001 [1]

Answer:

the act or process of changing to better suit a situation. 2 : a body part or feature or a behavior that helps a living thing survive and function better in its environment. adaptation. noun.

Explanation:

hope it helps

6 0
3 years ago
Read 2 more answers
What was the main concern after the colonists won independence from Britain?
Gelneren [198K]
"Having a government that was too strong and powerful" was the main concern among the choices given in the question that the colonists had after they <span>won independence from Britain. The correct option among all the options that are given in the question is the second option or option "B". I hope it helps you.</span>
3 0
4 years ago
What allows humans to have different traits from each other?
larisa [96]
They have different genes.
7 0
4 years ago
Read 2 more answers
Anatomical similarities and differences between various organisms allow us to reconstruct
cestrela7 [59]

Answer:

the bones of the forelimbs arm

7 0
3 years ago
Psychology 101: Is it normal for school age people to have crushes on their teachers or professors?
nataly862011 [7]

Answer:

yes

Explanation:

he/she just you're crush nothing serious about that it's just infatuation that you feel about him or her

7 0
3 years ago
Other questions:
  • What are the 14 elements of the liver
    7·1 answer
  • In peas, the allele for yellow seeds (Y) is dominant to the allele for green seeds (y). What would be the genotype and phenotype
    15·1 answer
  • List two pro and cons of genetic engineering
    9·1 answer
  • En un juicio, se solicita una prueba de paternidad para esclarecer un conflicto donde dos hombres indican ser padres de dos adol
    6·1 answer
  • 5. Match the column
    15·1 answer
  • Which identifies the energy transformations that take place in Anna’s body as this process takes place?
    11·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • PROTEIN SYNTHESIS is an important cell process because it does what for cells?
    14·1 answer
  • Label the diagram below.
    7·1 answer
  • A DNA molecule is shaped like a twisted ladder, a shape that is called a(n) __________?​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!