1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sever21 [200]
3 years ago
7

What are three ways that substances can be described?​

Biology
1 answer:
Margaret [11]3 years ago
7 0

Answer:

chemical name, for example, benzene;

number, for example, EC number 200-753-7, and.

chemical composition, for example, >99 % benzene and <1 % toluene. The composition is determined by chemical analysis.

Explanation:

hope thishelps!

You might be interested in
Which of the following is NOT an impact of wildfires? (Notice it says NOT)
Alisiya [41]

Answer:

D - None of the above

Explanation:

3 0
3 years ago
Which of the answer choices is a cross section of the highlighted region of the mushroom in the picture
Daniel [21]

Answer:

<em>The mushroom in the picture and the option choices are included in the attached image. below...</em>

The highlighted region of the mushroom in the picture represents the mushroom's <em>"Gills"</em>, and paticularlly the multicellular structure carrying the <em>Hymenium</em> called <em>"the basidiocarp"</em> aka basidioma; the Hymenium or underside of the mushrooms is comprised of vertical plates arranged radially, and if a cross section of this is exposed by making a straight cut through the basidiocarp on a microscope, it would appear as option: (A. )

4 0
3 years ago
Which of the following will not contribute to resource conservation?
DaniilM [7]
<span>Here are the choices:
a. using solar power
b. recycling glass
c. using nuclear power
d. using biofuels

The answer is b. Recycling glass. It is not included in resource conservation since it is not coming from the natural resources. </span>
7 0
3 years ago
Read 2 more answers
Which foodborne illness is best prevented by controlling time and temperature?
soldi70 [24.7K]

While cooked rice meals are associated with the vomiting ailment, cooked veggies, animal products, and milk are frequently linked to the diarrhea ailment (rice pudding and fried rice). The easiest way to avoid it is to regulate the temperature and time.

<h3>What is meant by "foodborne disease"?</h3>

Foodborne illness is brought on by consuming contaminated foods or beverages. Foodborne infections can result from a wide variety of pathogens or disease-causing germs contaminating foods. Foodborne illnesses are typically caused by bacterial, viral, and parasite infections.

<h3>What are the 5 major foodborne illnesses?</h3>
  • Norovirus.
  • Salmonella.
  • Clostridium perfringens.
  • Campylobacter.
  • Staphylococcus aureus

<h3>What brings about food-borne illness?</h3>

Foodborne illness causes

Bacteria, viruses, and parasites are biological risks. Most foodborne infections are caused by bacteria and viruses. The greatest danger to food safety is posed by biological risks. They may be a result of improper handling (such as using excessive time or temperature) or inherent in the product.

To learn more about foodborne illnesses visit:

brainly.com/question/24477516

#SPJ4

4 0
2 years ago
Rhdndndndndnnddndndnndnx
BlackZzzverrR [31]

what do this mean do you want free points

5 0
3 years ago
Read 2 more answers
Other questions:
  • Use technologist in a sentence
    13·1 answer
  • Osmosis involves the movement of water molecules across a cell membrane. Diffusion involves the movement of substances other tha
    11·1 answer
  • Many trees shed their leaves during the autumn months when conditions are not suitable for photosynthesis. Which characteristic
    12·2 answers
  • What is the name of the bond that is created when two amino acids join?
    5·2 answers
  • Which best describes the volume of a liquid?
    8·1 answer
  • What cell structure allows the passage of oxygen to it's environment?
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Transcribe and then translate the following DNA strand:
    14·1 answer
  • As the world population grows it will become harder and harder to feed people worldwide, explain why some people may argue that
    7·1 answer
  • Urine is carried to the urinary bladder by Urine is carried to the urinary bladder by lymphatics. the ureters. blood vessels. th
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!