Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer: runoff is like when rain and water drains away
Explanation:
C it’s the answer for you
Answer:
If a protein or molecule is taken up by the cell and must be digested it will make use of <u>lysosomes</u>.
Explanation:
Lysosomes are membrane-bound organelles that have a wide range of functions but their main 'job' is to break down large molecules into smaller molecules or to digest molecules that are present in excessive or unnecessary amounts. This is why <u>they contain important digestive enzymes known as hydrolitic enzymes.</u>
Lysosomes can break down, for example, large proteins into amino acids to provide the cell with the necessary nutrients.
