1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
statuscvo [17]
3 years ago
12

PLSSS HELP IF YOU TURLY KNOW THISSS

Biology
1 answer:
Ymorist [56]3 years ago
4 0

Answer:

B. Organic Matter

Organic matter is what differentiate a mineral from a rock.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Why were chemical disinfectants once commonly compared with phenol?
kotykmax [81]

Answer:

The chemical components, which are utilized to eradicate or eliminate pathogenic microbes are known as chemical disinfectants. These comprise sodium hypochlorite, chlorine, bromine, hydrogen peroxide, chloramines, and others.  

Traditionally, the chemical disinfectants are usually compared with phenol as phenol was the first or the foremost used chemical agent for the purpose.  

4 0
3 years ago
Need help plzzzzzzzzzz
lyudmila [28]

I'm not 100% sure, but

1.) prokaryotic

2.) prokaryotic

3.) eukaryotic

4.) prokaryotic

6 0
3 years ago
Read 2 more answers
4
Sonbull [250]

Answer:

All choices are correct

Explanation:

The most well known was a botanist who studies plants too realized that plats,living things are made of cells so most likely the answer would be all living things are made of cells

I hope this helps, I am only in the 7th grade and this was pretty easy to me

5 0
3 years ago
In two to three sentences, explaining how the creation of recombinant DNA is like cutting and pasting
Galina-37 [17]
Recombinant DNA is a type of artificial DNA which have genes that are taken from different organisms. During this process, a gene is take from one organism and putting the gene into another organism. Basically, the technology follows cut and paste scheme to form the new brand of DNA.

So to conclude this the technology cuts part of the DNA out to create a new DNA so you are cutting and pasting new DNA which is incredible. 

Hope this helped. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • To insure accuracy transcription only occurs one time at any given Gene location on a strand of DNA. True or false?
    10·1 answer
  • The enzyme responsible for removing acetyl groups from histone proteins is called
    7·1 answer
  • Suppose you were in charge of sending an unmanned space probe to a new planet in search of life. The probe would be able to coll
    10·1 answer
  • Which is considered a scientific observation?
    12·2 answers
  • A fat is called ____ of all carbons of the fatty acid chain are single bonded
    10·1 answer
  • Which is a process that eliminates harmful alleles from a gene pool?
    14·2 answers
  • In nuclear fusion high pressure and temperature fuse two deuterium nuclei and transform into?
    5·2 answers
  • What do phototropism and geotropism enable plants t do
    15·1 answer
  • Expanding of matter when it is heated is known as
    12·1 answer
  • Fossils are found in:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!