A chemical messenger is any compound that serves to transmit amessage. A chemical messenger may refer to: Hormone, Long rangechemical messenger. Neurotransmitter, communicates to adjacent cells.
Sea otters affected biodiversity because they control the
populations of sea urchins, which endanger kelp forests. Kelp
forests are important because they convert sunlight to living material, and
they also provide food and habitat to sea creatures. Kelp is important in
sustaining the diversity of ecosystems. Additionally, sea otters may also be accountable
for the large size of abalones in California.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
phytoplankton and bacteria
Explanation:
