1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
13

The hair on Jamal’s arms is standing straight up.

Biology
1 answer:
Taya2010 [7]3 years ago
3 0

Answer: A

Explanation: Because I said so.

You might be interested in
A woman standing and watching the stars on a cool, calm night will lose most of her body heat by _________.
Licemer1 [7]

A woman standing and watching the stars on a cool, calm night will lose most of her body heat by radiation. so correct option is A

The emission or transmission of energy as waves or particles across space or a material medium is known as radiation. Thermal radiation will cause the majority of the woman's heat to escape from her body. Evaporation is not a actual process because evaporation is  a cooling process rather than a means of heat transfer since latent heat is lost during the process There will be little convection and conduction in this situation.  

To know more about radiation:

brainly.com/question/9108146

#SPJ4

5 0
2 years ago
Describe the process of photosynthesis. What ingredients does a plant need in order to complete photosynthesis? After photosynth
forsale [732]

Answer:

Photosynthesis, the process by which green plants and certain other organisms transform light energy into chemical energy. During photosynthesis in green plants, light energy is captured and used to convert water, carbon dioxide, and minerals into oxygen and energy-rich organic compounds, Three main ingredients are required for photosynthesis: water, carbon dioxide, and light. Plants use light energy from the sun to convert six water molecules (6 H2O) and six carbon dioxide molecules (6 CO2) into a molecule of glucose and six molecules of oxygen, Carbohydrates(glucose) and Oxygen is the end product.

4 0
3 years ago
Read 2 more answers
What is an educated guess posed as a tentative explanation called
Leokris [45]
An educated guess that is aslo posed as a tentative explanation is called a hypothesis.

4 0
4 years ago
What is the role of lay person like you in the mission of the church today?
sesenic [268]

Explanation:

base on the person opinion

3 0
3 years ago
Which of the following is an important exception to the central dogma of molecular biology? a) Proteins are responsible for most
iogann1982 [59]

Answer:

b: many genes code for RNAs that function directly in the cell

Explanation:

<em>The central dogma</em> theory describes the basic framework for gene expression in living organisms. Genetic information from DNA is encoded or transcribed as RNA which then becomes translated as proteins.

The processes that take place for gene to be successfully expressed are;

  • Replication
  • Transcription
  • Translation

<em>Replication</em> is a process whereby DNA makes a copy of itself to be distributed in daughter cells during cell division.

<em>Transcription</em> is the process whereby genetic information in DNA is encoded as RNAs. The RNAs are short-lived as they are quickly utilized in protein synthesis or <em>translation </em>process.

Hence, the RNAs do not function directly in the cells but mere intermediaries in the synthesis of proteins.

<em>The correct option is b.</em>

3 0
4 years ago
Other questions:
  • If there was zero change in earths eccentricity how might that affect the possibility of an ice age?
    13·1 answer
  • Why is pink visible in carnation plants
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which atom is involved in giving your heart energy to beat?
    7·2 answers
  • What is the largest species of pinniped
    8·1 answer
  • The plasma membrane, according to the fluid-mosaic model is composed mainly of What and Proteins
    10·1 answer
  • Which list below describes a possible path of rain through the water cycle?
    8·2 answers
  • Catfish are freshwater fish that have "whiskers" with taste buds, as well as a keen sense of smell for locating prey in murky wa
    10·2 answers
  • What allow animals to perform their functions
    6·1 answer
  • In your own words, what is the definition for substrate with enzyme.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!