1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelu [443]
3 years ago
10

Uses of agriculture land​

Biology
2 answers:
Mandarinka [93]3 years ago
7 0

Answer: All ecosystems modified or created by man specifically to grow or raise biological products for human consumption or use. This includes cropland, pasture, orchards, groves, vineyards, nurseries, ornamental horticultural areas, and confined feeding areas.

3241004551 [841]3 years ago
5 0
You can farm and plant food to eat
You might be interested in
Which type of chemical bond holds the atoms together within a molecule of watermelon
Tomtit [17]

Answer:

Water (H2O) can be called a molecule or a compound because it is made of hydrogen (H) and oxygen (O) atoms. There are two main types of chemical bonds that hold atoms together: covalent and ionic/electrovalent bonds. Atoms that share electrons in a chemical bond have covalent bonds.

7 0
3 years ago
How does an organism's niche differ from its habitat?
mars1129 [50]

Answer:

An organisms niche is it's role in the ecosystem. This includes what it eats and what it's eaten by, and is usually affected by it's habitat.

An organisms habitat is simply where the organism lives.

6 0
3 years ago
Barometers are used to measure which of the following?
Natali [406]

Answer:

atmospheric pressure

Explanation:

hope this helps sweetheart

4 0
3 years ago
Complete the following statement carbon dioxide water and energy are the reactants for. well beginnings the products for
Strike441 [17]

Photosynthesis. These are the reactants for photosynthesis and the products of cellular respiration.

5 0
3 years ago
What is another term for the boreal forest?
OlgaM077 [116]
According to my old biology book 2 terms include snow forest and Tagia
3 0
3 years ago
Read 2 more answers
Other questions:
  • A mineral hat has ____ can be split fairly easily along planes with weak atomic attraction
    13·1 answer
  • Which begins as kinetic energy and can be transformed into mechanical energy and electricity?A. oil B. natural gas C. sunlight D
    10·1 answer
  • PLEASE HELP!
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How does acid preperation affect land and water organisms?
    5·1 answer
  • The desert and tundra are alike because they both have A) extreme daily temperature changes. B) large seasonal variation. C) lim
    7·2 answers
  • When a chromosomes undergoes a deletion mutation, information is ?
    7·1 answer
  • PLEASE HELP ASAP THE QUESTION IS IN THE PICTURE
    10·1 answer
  • The layer of the uterine wall that is shed during menstruation is the:.
    10·1 answer
  • You are microscopic and stranded inside the right atrium during passive ventricular filling. How many potential escape routes do
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!