1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
11

What challenges would you expect scientists to face when growing plants in space? What challenges will the astronauts have with

meeting their own energy needs?
Biology
1 answer:
DanielleElmas [232]3 years ago
4 0

Answer:

the challenges they would expect to see is the plants not having water or air

planted need water to have photosynthesis and since theres no water in space and little to no atmosphere the plants would suffocate

You might be interested in
Which elements are best known for helping performers memorize an epic poem?
arsen [322]
The elements that are best known for helping performers memorize an epic poem are rhyme, rhythm, and repetition of certain words.
6 0
3 years ago
Explain your observations. What did you observe? Submit your data chart here.
Genrish500 [490]
What observations are you talking about
8 0
3 years ago
PLZ HELP DUE IN 30 MINS
Alinara [238K]

Answer:

1)The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

4 0
2 years ago
A bacterium is made of _____ cells.
guapka [62]

Answer:

prokaryotic cells

Explanation:

7 0
3 years ago
1. Which of the following is true about chemical energy?
avanturin [10]
What is true of chemical energy is that chemical energy can be stored more efficiently as glucose than it can be as ATP. All the other answers in this case don't really apply. The correct answer is therefore A.

When ATP is broken down to ADP we get a release of energy - B and C are therefore wrong. Energy is broken in more ways as only ADP - D is also wrong. Only A stays as the correct answer. 
8 0
4 years ago
Read 2 more answers
Other questions:
  • Two lakes have the same number of species. most of the fish in lake 1 are of a single species, with a few individuals each for t
    10·1 answer
  • Uplift occurs at a rate of 0.1 m per 1,000 years.
    14·2 answers
  • During translation, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short se
    15·1 answer
  • A volcanic eruption produces a large amount of smoke which affects the lungs of animals. Which of these Earth systems interact d
    14·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • what is an important principle of the scientific method in which an experiment can accurately be reproduced by an independent re
    11·1 answer
  • Match the statement with the correct term. When a characteristic is subject to a range in severity or degree of expression in th
    11·1 answer
  • We know that a continental polar air mass bring cold dry air, where
    14·1 answer
  • Write a paragraph about cell structure
    13·1 answer
  • Hemophilia is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!