1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
10

What is endocrinegland?​

Biology
1 answer:
lukranit [14]3 years ago
3 0
An endocrine glad is ductless glad in the body that releases hormones directly into the bloodstream
You might be interested in
Potatoes are specialized stems that store food for potato plants. Which main tissue would you expect to primarily make up a pota
ratelena [41]
<span>Potatoes are also known as tubers and they commonly make up most of the carbohydrate needs that the body can get from food. It is made up of parenchyma tissue that makes the plant have the ability of cloning and low metabolic activity. They are commonly used for experimentation as a “model tissue” because of these characteristics. <span>
</span></span>
5 0
3 years ago
Read 2 more answers
To protect our rights, the Constitution divides powers between the federal government's branches. This principle is called "sepa
svet-max [94.6K]

Answer:

Explanation below

Explanation:

Separation of powers is very important and crucial in federal type of government. This is helpful because it decentralized the power, and prevent one arm of government from being a dominating force.

It will help the government to provide the necessary and needed infrastructure for the citizens. This is because the conclusion will be reached with approval of all the arms of government.

8 0
3 years ago
In 1885, Albert Bernhard Frank introduced the term "mycorrhiza" to describe the symbiotic relationship that occurs between fungi
Zielflug [23.3K]
I am not for sure try quizlet
4 0
2 years ago
In multicellular organisms, life begins as a single cell until ___________ occurs, causing growth.
Arturiano [62]

The right option is; D) mitosis

In multicellular organisms, life begins as a single cell until mitosis occurs, causing growth.

Mitosis is a process of cell division, and a part of the cell cycle in which a single cell divides, and produces two identical daughter cells (new nuclei) that contains the same shares of the parent’s cell part. Mitosis occurs in multi cellular organisms, and its primary purpose is for growth, and to replace worn out cells. Mitosis contains four basic stages which are; prophase, metaphase, anaphase, and telophase.  


3 0
3 years ago
Read 2 more answers
The importance of the media in a democratic country such as south Africa
jenyasd209 [6]
So they can communicate with other people to find out more about every candidate before they vote <span />
7 0
3 years ago
Other questions:
  • What material (food/air) frog trachea transport? for a frog
    12·1 answer
  • BRAINLIESTTTT ASAP!<br><br> How are food and oxygen made during the process of photosynthesis?
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • a ball is tossed up in the air. at its peak it stops before beginning to fall. the ball at its peak has
    11·2 answers
  • Gene splicing is used to produce what
    6·1 answer
  • Which feature or property of water allows plants to draw liquid water up from their roots?
    11·2 answers
  • I need help with this IMMEDIATELY I will give 20 points and give a brainliest answer if someone answers it. PLZ HELP ME NOW!!! W
    12·2 answers
  • Pls help question is in picture
    10·2 answers
  • Chromosomal mutations are changes in the normal structure or number of chromosomes. Changes in chromosome structure can result f
    7·1 answer
  • Why is it crucial that the daughter cells have identical copies of dna after replication?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!