1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
5

Fatty acids are the building blocks of.

Biology
2 answers:
nikklg [1K]3 years ago
8 0
It’s most likely lipids! Hope this helps
Genrish500 [490]3 years ago
5 0

Fatty acids are building blocks of lipids. The correct option is A.

Fats and oil are known as lipids.

Lipids are part of the classes of food which are made up of high proportion of carbon and hydrogen with very little oxygen.

Fats are solids and oils are liquids at room temperature. They serve the following functions to the body:

  • They provide the body with energy
  • They are solvents for fat-soluble vitamins and hormones.

Before lipids can be absorbed into the body, they must be broken down into fatty acids and glycerol.

Therefore, fatty acids are building blocks of lipids.

Learn more here:

brainly.com/question/17352723

You might be interested in
Which statement best distinguishes plant and animal as they relate to amino acids?
alukav5142 [94]

Ans.

There are twenty amino acids that take part in protein synthesis. These amino acids act as precursor for all protein molecules and are known as essential amino acids. Plants can synthesize all twenty amino acids from simple precursors, while animals can make only twelve amino acids. Animals obtain remaining eight amino acids by eating plants.

Thus, the correct answer is 'option) D.'


4 0
4 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Living organisms must constantly take in energy in order to power functions necessary to remain alive. the chemical reaction tha
Alexxx [7]
Respiration ~~~~~~~~
7 0
3 years ago
12. Fluid_
Alona [7]

Answer:

B

Explanation:

8 0
3 years ago
Read 2 more answers
CPR, or cardiopulmonary resuscitation, is a first-aid technique to help save lives. It involves compressions of the patient’s ch
fgiga [73]

Answer:

A

Explanation:

8 0
3 years ago
Other questions:
  • The chemical energy stored in ATP during photosynthesis is released during the dark phase to
    14·1 answer
  • The cytoplasm is the watery fluid found within cells. The cytoplasm holds all of the organelles, except _______, in place within
    9·2 answers
  • How do cells maintain water balance through osmosis?
    14·1 answer
  • What is a word that means something made up of water land and atmosphere
    14·1 answer
  • How can environment speed up mechanical weathering
    8·1 answer
  • All BUT one factor contributes to biological evolution. That is...
    11·2 answers
  • Graph the following information in a BAR graph. Label and number the x and y-axis appropriately.
    10·1 answer
  • Select a region of the world and explain how its latitude, elevation, geographical
    10·1 answer
  • Explain how the release of energy (cooling) affects the speed of the particles in a substance
    11·1 answer
  • The question is in the picture
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!