1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
8

When a pathogen is growing and multiplying within or on a host (which may or may not result in overt symptoms) this is known as

a(n) ______. Multiple choice question. infection latent infection infectious disease opportunistic infection
Biology
1 answer:
serg [7]3 years ago
6 0

Answer:

Infection would be the answer for the blank

You might be interested in
Ihich of these is the best definition of
BigorU [14]

Answer:

D) the sum of all physical properties of a substance

4 0
3 years ago
If Huntington's disease is due to a dominant trait, shouldn't three-fourths of the population have Huntington's while one-fourth
4vir4ik [10]
This would be probably true if the assumption that all possible genotypic variations would be equally distributed (so we would have 25% HH, 25% hh and 2x 25 Hh). If this distribution would be true and Huntingtons disease really was a single gene dominant trait diesase, then yes, we could expect such a distribution in the population. 
8 0
3 years ago
How do DNA mutations change proteins?
Aleksandr [31]
A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated into a protein because of change, that single DNA sequence change, results in a different amino acid codon which the ribosome recognizes.
7 0
3 years ago
Define hydrosphere. <br>guys please help me<br>​
Ivanshal [37]
The total amount of water in the planet
6 0
3 years ago
Read 2 more answers
Match each description with the correct taxonomic grouping.
Ad libitum [116K]

1 .insecta

2.arachnida

3.  bryophyta

4.  mollusca

5.  mammalia

6.  aves

<u>Explanation:</u>

six legs and three body parts- insecta

2.eight legs and two body parts- arachnida

3. non-vascular and reproduces by spores- bryophyta

4. soft bodies with hard shells- mollusca

5. give birth to live young ones- mammalia

6. lays eggs on land and flies- aves

5 0
3 years ago
Other questions:
  • Do the chromosomes of plants usually occur in pairs just as those of animals do?
    13·1 answer
  • Choose all the answers that apply
    8·1 answer
  • Which category of carbon-based molecules includes sugars and starches?
    15·1 answer
  • What male reproductive structure releases sperm into the vas deferens?
    10·1 answer
  • Because it is often difficult to gather numerical data, ____ information is collected.
    9·2 answers
  • How do layers B and D compare in age? If rock layers between B and D eroded away what would be left between them?
    5·1 answer
  • This one is easy<br>please help : )​
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • HELPP PLSSS, I WILL APPRECIATE EVERY SINGLE ANSWER
    13·1 answer
  • Provide an environment (bowl or container) filled with 100 of each "prey" type (Consider beans, uncooked pasta, or cotton balls)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!