1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VMariaS [17]
2 years ago
10

One strand of a DNA molecule has the base sequence GAGTTA. The complementary base sequence on the other strand of DNA will be

Biology
1 answer:
Olenka [21]2 years ago
4 0
GAGTTA is what you have.
CTCAAT is what you’ll get.
A matches with T, G matches with C, and U is only for translating out of the DNA sequence.
You might be interested in
Which of the following statements correctly identifies the location of the hydrogens bonds in DNA
asambeis [7]

Answer:

This question is incomplete as it lacks options. However, it can be answered based on general knowledge of the DNA structure.

Hydrogen bonds in a DNA are located between the nucleotides that holds the double stranded DNA molecules.

Explanation:

Deoxyribonucleic acid (DNA) is the genetic material in living cells. The DNA molecule is made up of nucleotides monomers. However, since the DNA molecule is double-stranded, the nucleotides are of two chains composed of four nucleotide subunits viz: Adenine (A), Thymine (T), Guanine (G) and Cytosine (C).

The two chains of nucleotides in a DNA molecule are called strands. Each strand is bonded to one another by the nucleotides using complementary base pairing i.e. A-T, G-C. The bonds between the nucleotidew of each strand is called HYDROGEN BOND.

Hence, HYDROGEN BONDS in a DNA molecule is located in between two nucleotides of each strand. That is, hydrogen bond holds Adenine to Thymine and Guanine to Cytosine.

3 0
2 years ago
Read 2 more answers
. This ecosystem is common in central and northern Asia. Flora include mosses, grasslands, and hardwoods. Animals of this ecosys
masha68 [24]
<span>#1) What ecosystem is described in the paragraph above?

Answer: The ecosystem that is being described in the paragraph above is Tundra. The reason being that the flora and fauna described are from cold climates. Also because the snow leopards are usually found on the tops of mountains, where the climate is cold and windy and rainfall is adequate.

<span>I hope it helps, Regards. </span></span>
5 0
3 years ago
What is the bottle neck effect? ​
inessss [21]

Answer:

The bottleneck effect, also known as a population bottleneck, is when a species goes through a "bottleneck" event that suddenly significantly reduces its population. ... The bottleneck effect is a type of genetic drift, which is defined as a random change in allele frequencies.

7 0
3 years ago
Which of the following can cause a communicable disease?:
schepotkina [342]

the answer is

c. virus

4 0
3 years ago
Which type of chromosomal disorders seems to have the greatest affect on a person's health disorders involving autosomes or sex
mixas84 [53]
<span>monosomy 1 is bad because your missing a chromosome</span>
7 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of the following characteristics does an arthropod have? segmentation endoskeleton jointed appendages notochord coelom tis
    5·2 answers
  • choose the animal belonging to pisces group: silver fish, sea horse,dolphin, lobster. answer asap! thx​
    14·1 answer
  • What are the characteristics of carbon bonds?
    5·1 answer
  • Where would a pictograph not appear in a experimental outline
    13·2 answers
  • Compare What is the main difference between astronomy and other branches of Earth science?
    9·1 answer
  • Match each type of organic compound to its description.
    12·1 answer
  • 9. A therapist who believes that depression is caused by the way people THINK
    6·2 answers
  • The transfer of energy as electromagnetic waves is called
    7·1 answer
  • Public transportation is the most fuel efficient way to get to your local store. Please select the best answer from the choices
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!