1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
2 years ago
6

Which molecule is used to tell tRNA which amino acid is needed?

Biology
2 answers:
Alex17521 [72]2 years ago
8 0

Answer:

B. mRNA

Explanation:

anticodon – a sequence of three nucleotides on a tRNA molecule that bond to a complementary sequence on an mRNA molecule. The anticodon sequence determines the amino acid that the tRNA carries.

just olya [345]2 years ago
5 0

Answer:

B. mRNA

Explanation:

The mRNA is used to tell tRNA which amino acid is needed.

You might be interested in
Camel humps are an adaptation for _______.. a.. storing water. b.. regulating body heat. c.. carrying riders. d.. all of the abo
Fofino [41]

The correct answer is:

b regulating body heat.

Explanation:

Camels have humps on their backs as rooms to store fat. It is this fact that they live off when food and liquid are scarce. A well-fed camel in good shape has a firm, upright hump. After a long, exhausting wilderness journey the corresponding camel will have a hump that does floppy and bent over to one side.e. Concentrating body fat in their humps reduces heat-trapping.

6 0
3 years ago
Read 2 more answers
Gabriel has developed diarrhea as a result of taking an antacid. what does the antacid likely contain?
lora16 [44]

If Gabriel developed diarrhea as a result of taking an antacid, he's been taking an antacid that contains magnesium.

Magnesium will act as a laxative.

4 0
3 years ago
A forest ecosystem can support a limited number of bears. This is because
taurus [48]
A forest ecosystem can support a limited number of bears. This is because available energy is lost from one trophic level to the next. (flies, trout, then bears)
8 0
3 years ago
Read 2 more answers
What does the large vacuole do?
FrozenT [24]
The large vacuole stores water and other materials for a plant cell

4 0
3 years ago
Read 2 more answers
​why is it that bottle-feeding a baby in developing nations has so much potential to be disastrous to the baby's health
Butoxors [25]

It is dangerous to the baby bottle feeding because of the only water available to prepare formula is often contaminated, which can lead to diarrhea, dehydration, and/or death.  This may also bring the risk for the babies especially when the bacteria develop and contaminate the feeding bottle. 

7 0
3 years ago
Other questions:
  • Which term describes the chromosomal abnormality of having extra chromosomes?
    11·2 answers
  • What is the movement of air in and out of lungs called
    12·2 answers
  • Method use in identifying farm animal​
    11·1 answer
  • Some transgenic animals grow faster because they have extra copies of growth hormone genes
    11·1 answer
  • Researchers performed an experiment to investigate DNA replication. First, they synthesized radioactively-labeled nucleotides, w
    5·2 answers
  • The dates shown in the diagram above refer to the ages of __________
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • ¿Cuál de los siguientes niveles es el sucesor del nivel tejido?
    9·2 answers
  • How does cellular respiration provide energy for life processes?​
    8·1 answer
  • Why does an increasing population cause
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!