Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
I think the answer is C. C24H42O21+3H2O
Explanation:
Protista are unicellular organisms that do have a nucleus. They can reproduce both sexually and asexually. They live in moist environments.
<h3><u>Explanation:</u></h3>
Kingdom Protista consists of the organisms that are unicellular or pseudo multicellular and they are eukaryotic in nature.
The classes under Protista consists of Chrysophytes, Dinoflagellates, Slime moulds, Euglenoids and protozoans. These organisms are all unicellular. They are all the eukaryotic organisms. Euglenoids are photosynthetic where the protozoans are consumers and Slime moulds are saprophytic. They prefer to live in water or moist lands. These organisms can reproduce both asexually or sexually.
Answer:
The fluid mosaic model was used to explain the structure of the cell membrane. This model was well accepted model and given by Singer and Nicolson.
According to this model, the cell membrane is composed of lipids and proteins. The lipid layer is arranged and the proteins are inserted or span the bilayer. Some proteins are trans-membrane proteins, peripheral proteins and integral membrane proteins. Cholesterol are also inserted in this membrane. The carbohydrates are present in association with proteins or lipids on the cell membrane.
