1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
13

An unsaturated fat has the maximum number of hydrogens attached to the carbon backbone.

Biology
1 answer:
xz_007 [3.2K]3 years ago
4 0

Answer:

The answer is true.. it is attached to the carbon backbone.

You might be interested in
What contracts to pump blood out of the heart?
OlgaM077 [116]
Left ventricular must be right answer
6 0
3 years ago
Read 2 more answers
The figure below shows bands of DNA that were separated using gel electrophoresis. Which band contains the smallest DNA fragment
diamong [38]
I believe the answer would be Band C.
6 0
3 years ago
Does anyone know what we need to do on here?
Lera25 [3.4K]

Answer:

identify the variables

Explanation:

control:type of lemon used

dependent:whether apple slice turns brown at pH>2

independent:pH value

3 0
3 years ago
Why is carbon so good for forming the structure
vova2212 [387]
Carbon can bond up to 4 times so it can be stronger in some cases than other elements.
4 0
3 years ago
Carbon dioxide goes from a solid to a gas without becoming a liquid. This is a chemical change.
Keith_Richards [23]

Answer:

I think its true

Explanation:

hope this helps

6 0
3 years ago
Read 2 more answers
Other questions:
  • What percent of one’s daily caloric intake should come from carbohydrates?
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is the function of the cell membrane in a cell?
    5·1 answer
  • What happens in the proliferation stage of wound healing?
    14·1 answer
  • During what stage does land get ready for the arrival of a new species
    6·1 answer
  • In place of thymine, what does RNA use as a base <br><br> Please help
    11·1 answer
  • Which cells do not respond to the signals that regulate the growth of cells
    13·1 answer
  • The sweet potato is a common crop plant found in most warm areas of the world. The plant rarely flowers and more rarely makes se
    7·2 answers
  • The moon itself doesn’t emit any _____ like the sun.
    11·1 answer
  • Hii! Please help me on this question!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!