1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
13

You are asked to calculate an object's velocity. In order to do so you must know the object's

Biology
1 answer:
vfiekz [6]3 years ago
5 0

Answer:

You must know the object's distance and time of acceleration

Explanation:

You might be interested in
3. An irregularly shaped stone was lowered into a graduated cylinder
MA_775_DIABLO [31]

Answer: the rocks density and the waters density would stay the same. It does not change

Explanation:

4 0
3 years ago
True or false?
jonny [76]

Answer:

true

Explanation:

hope this helps

stay safe

brainliest is appreciated i only need two more  to level up please help:))))

8 0
3 years ago
A standard PCR cycle includes three steps: denaturation (95°C), annealing (55°C), and elongation (65°C).
xz_007 [3.2K]

Answer:

Denaturation process: The DNA template  

Annealing process: Primers  

Elongation process: dNTPs and Taq polymerase

Explanation:

For the denaturing process, the only ingredient that is required is the DNA template that will be separated from a double helix (or double strand) into a single strand, by increasing the temperature to 95 C, (at this temperature the hydrogen bonds that keep together the double stranded break). After the double strand is denatured, the following process is annealing. For this, the required ingredient are the primers; these primers will hybridize or anneal according to the nucleotide complementarity to the single strand of the DNA. Finally, for the Elongation process, you will require the Taq polymerase and the dNTPs. The enzyme will synthesize or “generate” a new strand of DNA based on the DNA template, using the provided dNTPs in the direction 5’ to 3’.

I hope this clarify you inquiry.  

6 0
3 years ago
Seed ferns produced seeds but did not produce
Genrish500 [490]
Your answer is C hope that helped
4 0
3 years ago
Read 2 more answers
How does cladistics help us understand phylogeny
Rom4ik [11]
Cladistics is based on the shared characteristics between organisms and their network of evolutionary relationships
5 0
3 years ago
Other questions:
  • Can anyone help me with this?​
    14·2 answers
  • A piece of bread held in the mouth begins to taste sweet as large carbohydrate molecules are broken down into smaller sugars. th
    5·1 answer
  • This is the energy needed by a system to initiate a process.
    11·2 answers
  • A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complem
    10·1 answer
  • What would a scientist most likely do to demonstrate the effects of a tsunami?
    7·2 answers
  • Why is it good for aquatic organisms that live in cold climates that ice floats?
    10·1 answer
  • Which of the following is a cost of urban development?
    14·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • One function of the chromosomes in a cell is to...
    15·1 answer
  • If the normal body cells of an organism each contain 36 chromosomes, how many chromosomes would be found in a gamete produced by
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!