Explanation:
After repeated stimulation by antigen, B cells can make antibodies that bind their antigen with much higher affinity a process called affinity maturation. ... Thus, antigen stimulation greatly increases the antibody arsenal. Antibodies are proteins, and proteins are encoded by genes.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Overgrazing is a cause of desertification, so c.
The presence of a tumor in the larynx is known as Laryngeal cancer. It may affect the process of breathing, speaking, and swallowing of the food down to the esophagus.
<h3>What are the properties of a cancerous cell?</h3>
Cancerous cells have numerous properties. Some of them are as follows:
- It is an undifferentiated cell that continues uncontrolled rapid division and proliferation.
- It is immortal which means allows the inhibition of apoptosis.
- It follows the process of metastasis.
Laryngeal cancer disturbs the passage of air in and out of the lungs through the larynx and trachea. The process of migration of cancerous cells from the initial origin to the other connections may describe as metastasis.
Laryngeal cancer is caused primarily by smoking, drinking alcohol, and other age-related issues. The symptoms of this cancer may include voice changes, sore throat, or a cough that resides long away.
Therefore, it is well described above.
To learn more about Cancerous cells, refer to the link:
brainly.com/question/373177
#SPJ1
Answer:
the process of turning from liquid into vapour
