1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
2 years ago
6

Hiiiiiiii please help me please >-< 35 points!

Biology
1 answer:
Travka [436]2 years ago
6 0

Answer:

I just answered this same question for my Biology class hope this helps :)

Explanation:

A hydrogen bond is when positive and negative hydrogen forms together; this explains why cohesion sticks molecules together . Because of cohesion, the water molecules stick together and form a surface; this property is responsible for surface tension. Adhesion is the ability for water to stick to other substances; this helps with capillary action. Hydrogen bonding also explains why water's boiling point is higher than some liquid . With this, water has a high specific heat; this is because the water takes a lot of energy to raise (or lower) the temperature. Once again, hydrogen bonding is essential to another property. This property causes water to expand and to have a low density when frozen.

You might be interested in
In the ABO series, the gene for blood type O is , while A and B are genes, and AB is .
Nesterboy [21]

Answer:

Gene for blood type O is recessive

Gene for blood type A and B is dominant

Gene for blood type AB is neither dominant nor recessive but a form of co-dominance

Explanation:

In the ABO blood group,  

A and B are dominant genes, O is recessive genes.  

So the different genotype and its corresponding phenotype is as follows –  

Genotype    Phenotype

AO     A

BO     B

AB     AB

AA     A

BB     B

OO     O

Hence, the two alleles AB occur and express together. Therefore, AB blood group is an example of co-dominance.  

Blood type also varies with the presence of Rh factor. If Rh factor is present, the blood type will represented with a “+” symbol. And if Rh factor is absent, the blood type will be represented by “-“symbol.

6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Which of the following human activities reduces biodiversity
netineya [11]
Planting only red pine trees to replace native hardwood forests cut for lumber.
6 0
3 years ago
If we were to compare the muscle cells of the puma to the epithelial cells, the muscle cells would contain relatively more A) ri
Grace [21]
D ribosomes because it makes the energy for the cells
3 0
3 years ago
Read 2 more answers
The macromolecule that carries that code for building our body?
a_sh-v [17]
Nucleic acid is the macromolecule that carries code for building our body. 
3 0
3 years ago
Other questions:
  • How do you think scientific knowledge will be different in 100 years?
    9·2 answers
  • Unlike mitosis, meiosis results in the formation of
    14·2 answers
  • After what process does each daughter cell receives an exact copy of the parent cells DNA
    7·2 answers
  • The culinary term used when cutting a food lengthwise into very thin, stick-like shapes is
    5·2 answers
  • The digestive system is critical to maintaining a healthy body because
    7·2 answers
  • Describe the three types of mammals. Give examples of each. How is reproduction/offspring different in each?
    7·2 answers
  • Which of the following statements about planetary satellites is true?
    9·1 answer
  • What is included in Earth’s hydrosphere?
    6·2 answers
  • What features relate cephalopods to other mollusks
    6·1 answer
  • What energy is transferred during translation
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!