1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VladimirAG [237]
3 years ago
6

2. Place the five examples below in order from largest to smallest:

Biology
1 answer:
PtichkaEL [24]3 years ago
3 0

Answer: You, Digestive system, Stomach, Epithelial Tissue, Parietal cells.

Explanation:

You might be interested in
Carbohydrate loading maximizes the amount of which substance stored in skeletal muscles?
Romashka [77]

Answer:

The correct answer is d. glycogen

Explanation:

Carbohydrate loading is a very common practice in athletes. It consists of eating carbohydrate-rich food specially before doing exercise. This practice maximizes the stored quantities of glycogen- polysacharide of storing of glucose- in muscle and liver.

3 0
4 years ago
Ed was in a bicycle accident, he had no sensations in his injured leg. He can move the limb normally. Based on the functional cl
____ [38]
There are two types of neurons in our legs: motor neuron and sensory neuron. These send and receive messages to and from each other and the brain.  

After Ed's accident, he can't move his injured leg since the motor neuron is dysfunctional. The sensory neuron is functional so he can feel his limbs but can't move them since when the sensory neuron sends a message to the motor neuron, it isn't able to deliver the message to the brain to make the leg move. This is why he can still feel his limbs but is not able to move them.  
7 0
3 years ago
Which of the following molecules are not required to express a gene in eukaryotic cells?
slava [35]

Answer:

Repressor protein

Explanation:

Repressor is a protein that binds to deoxyribonucleic acid(DNA) or ribonucleic acid(RNA) it inhibits the expression of one or more genes which is done by binding to the associated silencers.

A DNA binding repressor works by blocking the attachment of RNA polymerase an enzyme that enhance transcription to the promoter, thus preventing genes from been transcribed into messenger RNA.

An RNA binding repressor binds to the messenger RNA and prevents translation of the bases on the messenger RNA into protein. The blocking of expression is called repression.

4 0
3 years ago
Below is a segment of a strand of normal DNA:
Ede4ka [16]
This would be an example of:
C) an insertion mutation.

Notice how the sequence contains the same letters as before, only an A is added to the beginning. Adding extra nucleotides is an example of an insertion mutation, a type of frame-shift also, because the reading frame will be thrown off downstream.
3 0
4 years ago
If a cell keeps growing, why must it eventually divide
iragen [17]

Answer:

What are two reasons why cells divide rather than continue to grow indefinitely? a) The larger a cell becomes the more demand the cell places onto its DNA. b) The larger a cell becomes , the more trouble the cell has moving nutrients and wastes across the cell membrane.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a function of<br> Proteins
    10·1 answer
  • In a comparison of birds and mammals, the condition of having four limbs is _________.
    10·1 answer
  • What is the part of a cow that releases milk?
    6·1 answer
  • Does the following equation represent photosynthesis or cellular respiration?
    8·1 answer
  • The term that describes an animal that feeds on organic matter of dead organisms
    11·1 answer
  • During the development of a multicellular organism, its cells specialise. What is this process of specialisation called?
    13·2 answers
  • How is relative-age dating used to determine the ages of fossils?
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Cells responsible for histamine release
    7·1 answer
  • If the number of trees on the planet suddenly decreased, what might happen to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!