1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergejj [24]
3 years ago
11

ARTICLE ABOUT CHARACTERISTICS of Gaseous EXCHANGE

Biology
1 answer:
Angelina_Jolie [31]3 years ago
6 0

Answer:

Gas exchange is the physical process by which gases move passively by diffusion across a surface. For example, this surface might be the air/water interface of a water body, the surface of a gas bubble in a liquid, a gas-permeable membrane, or a biological membrane that forms the boundary between an organism and its extracellular environment.

Gases are constantly consumed and produced by cellular and metabolic reactions in most living things, so an efficient system for gas exchange between, ultimately, the interior of the cell(s) and the external environment is required. Small, particularly unicellular organisms, such as bacteria and protozoa, have a high surface-area to volume ratio. In these creatures the gas exchange membrane is typically the cell membrane. Some small multicellular organisms, such as flatworms, are also able to perform sufficient gas exchange across the skin or cuticle that surrounds their bodies. However, in most larger organisms, which have a small surface-area to volume ratios, specialised structures with convoluted surfaces such as gills, pulmonary alveoli and spongy mesophyll provide the large area needed for effective gas exchange. These convoluted surfaces may sometimes be internalised into the body of the organism. This is the case with the alveoli, which form the inner surface of the mammalian lung, the spongy mesophyll, which is found inside the leaves of some kinds of plant, or the gills of those molluscs that have them, which are found in the mantle cavity.

Explanation:

I hope this helps u ^_^

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Chromosome 17 is made of over _ million base pairs
marissa [1.9K]

I think it's 83 million base pairs.

5 0
3 years ago
Read 2 more answers
Please help I really would appreciate it
vekshin1

Answer:

Light, electric

Explanation:

4 0
3 years ago
A section through the renal cortex can be identified quickly by the presence of
Kazeer [188]

Answer:

Renal capsule.

Explanation:

The renal capsule is known as a fibrous layer. That fibrous layer helps to cover the kidney in a layer of perirenal fat (known as the adipose capsule). The renal cortex is known as the outer part of the kidney where ultrafiltration occurs. It is present between the renal medulla and the renal capsule.

The renal capsule is important for the physiological function of the kidney in the human body. It helps to influence interstitial pressure and consistently tubular reabsorption of water and sodium.

7 0
3 years ago
Does atomic mass equal number of protons plus the number of neutrons?
tankabanditka [31]
<span>The number of protons plus the number of neutrons is called the mass number.</span>
3 0
3 years ago
Other questions:
  • BRAINLIEST ANSWER!!!!!!!!
    8·1 answer
  • While many senior citizens are involved in activities such as church groups and volunteer organizations, others remain isolated
    8·1 answer
  • Why do atoms form bonds with each other
    13·2 answers
  • Explain how does cell structure relates to cell function?
    7·1 answer
  • Which event takes place during anaphase II of meiosis II?
    6·1 answer
  • Which of the following is a nonrenewable resource?
    11·2 answers
  • Which organisms contain chloroplasts to help with food production?
    7·1 answer
  • A football is kicked by a player. The ball travels 50 m, to the west when it is caught by another player and that player travels
    7·1 answer
  • Does anyone know how to mark someone Brainllest?
    8·2 answers
  • development of neuron-astrocyte co-culture system for mechanistic and pharmacological studies in neurodegeneration
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!