1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
6

Arrange the rock layers from oldest to youngest re-examine The rock outcrops if you need to. Record the order in the student gui

de.
Basalt

Limestone with unknown fossil

Sandstone with trilobite

Shale with ammonite​

Biology
1 answer:
ira [324]3 years ago
3 0

Answer:

Youngest to Oldest

Shale with ammonite

Limestone with unknown fossil

Basalt

Sandstone with trilobite

You might be interested in
What do lithium carbonate, carbamazepine (tegretol), and valproate (depakote) have in common?
NemiM [27]

All the mentioned drugs are mood-stabilizing drugs.

A mood stabilizer refers to a psychiatric pharmaceutical drug used in the treatment of mood disorders featured by sustained and intense mood shifts, usually borderline personality disorder, bipolar disorder type I or type II, and schizoaffective disorder.

The term mood stabilizer does not illustrate a mechanism, however, an effect. More accurate terminology is used to categorize these agents.

8 0
3 years ago
Which cells in the body are targeted by HIV?
Sindrei [870]
T cells. When HIV arrives in the lymph nodes – around 24 to 48 hours after exposure – they activate other immune cells, such as CD4 t-cells, HIV's primary target.
6 0
3 years ago
Read 2 more answers
Differential survival and reproduction is best described by which term?
Alex787 [66]
Darwin's theory of Natural Selection
5 0
3 years ago
Read 2 more answers
Plz Help if anyone know this I’m really struggling especially because this question is just 50 points it’s self.
goldfiish [28.3K]
The inner planets (in order of distance from the sun, closest to furthest) are Mercury, Venus, Earth and Mars.
5 0
3 years ago
Read 2 more answers
What is meant by "antiparallel" strands of DNA?
nataly862011 [7]

Answer:

DNA double strands are run in opposite direction  

Explanation:

The DNA is a macromolecule and is made of the polynucleotide. In a DNA, Polynucleotides are arranged in two strands or helices. The two strands are joined together by hydrogen bonds. Each stand has two ends. One end is called 5’ (5 prime) and the end is known as 3' (3 prime). The two stands in a DNA run in antiparallel or in an opposite direction. It means at one end, one strand is 3' and the other is 5' and at the other end one strand is 5' and another strand is 3'.

5 0
3 years ago
Other questions:
  • Which of these statements is the main reason smallpox was eradicated a.the smallpox virus only infects humans b.the virus is inh
    5·2 answers
  • Ow does the respiratory system help build social relationships? The respiratory system helps create sound that enables humans to
    12·2 answers
  • The three bones which amplify the vibrations of the ear drum are
    12·1 answer
  • If an atom has 34 protons, 23 neutrons, and 36 electrons, what would be it's atomic number?
    15·1 answer
  • A normal bleeding time in association with normal platelet count, and increased prothrombin time (PT) and INR, is indicative of
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 3 examples of relationships between geologic and biologic events
    10·1 answer
  • Please help me with this i have class soon
    6·1 answer
  • Need help with my work that all
    12·1 answer
  • The diameter of a human blood cell is 0.0000062m. How can this number best be expressed in scientific notation?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!