1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
12

What would be some alternative methods for girdling dicots?

Biology
1 answer:
34kurt3 years ago
6 0

The answer is marcotting. This is for trees, shrubs and semi-woody plants. The two cuts are then connected by a straight cut and the bark is pried loose and removed. This involves pressing of a sharp knife against the bark preferably as close as possible below a node, moving the knife in circular motion around the stem.

You might be interested in
Two or more organs form together to make what​
timofeeve [1]

Two or more organs form together make organ systems.

<u>Explanation:</u>

The basic unit of living organisms is the cell. Multiple cells makes up tissues and tissues make up organs. Two or more organs make up the organ system.

Human body has several organ systems. The organs that make up an organ system can be internal as well as external. Respiratory  system is made up of organs like lungs, nose, pharynx, trachea, diaphragm etc. digestive system is made with organs like liver, small intestine, stomach, mouth , large intestine, pancreas etc.

8 0
3 years ago
How do organ systems work together to deliver nutrients from food throughout the body?
Travka [436]

D- The digestive system breaks down your food and your circulatory system takes it throughout your body

4 0
3 years ago
Read 2 more answers
Some students at a middle school conducted a laboratory investigation to learn more about the physical properties of different e
TiliK225 [7]

Answer:

A

Explanation:

1. The colour is non metallic.

2. properties of metal solidness is not there, because of results of hammer experiment.

3. Physical consistency is not solid.

Etc.

4 0
3 years ago
Where is dna found in prokaryotic cells
yawa3891 [41]
Hi!

The answer is nucleoid .

Prokaryotic DNA can be found in a coiled loop floating in the cytoplasm in a region called the nucleoid .

Hope it helps and have a wonderful day!
5 0
3 years ago
DO YOUR CELLS HAVE ANYTHING IN COMMON<br> WITH PLANT CELLS?
Serggg [28]

Answer:

Explanation:

Yes. They both have a cell membrane. They have many organelles that animal cells have and a cell membrane is one of the few similarities.

4 0
3 years ago
Read 2 more answers
Other questions:
  • The angle that the Sun’s rays strike a region of Earth determines the amount of heat transferred.   Please select the best answe
    15·2 answers
  • Information about tigers
    14·1 answer
  • What is an ELLCO assessment
    8·2 answers
  • in sickle-cell disease variation is one gene cause red blood cells to bend or sickle this means the sickle cells
    10·1 answer
  • Describe how deep ocean trenches are related to deep ocean ridges. <br> pls help.
    5·1 answer
  • Plz help me asap thanks
    14·2 answers
  • Basalt is a rock that cooled quickly after lava erupted through a volcano. what is the best description of its texture
    11·2 answers
  • For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
    9·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How does air pollution affect the ecosystem?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!