1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
2 years ago
6

How has human interaction affected the Mississippi Delta?

Biology
1 answer:
BaLLatris [955]2 years ago
5 0

Explanation:

Sediment discharge was historically approximately 270 million cubic meters/year of suspended load and 130 million cubic meters/year of bedload. This has decreased 80% since 1850 and can be divided into three periods: historical period (pre 1900), pre-dam period (1932-1952), and post dam (1963-1982). Suspended sediment loads declined 43% between the historical and pre-dam and 51% from pre-dam to post-dam periods. The size of sediment also decreased drastically including a 72% decrease in the sand fraction. Most of this is due to dams on the tributaries acting as sediment traps primarily for the coarser sediments. Large-scale land clearing for agriculture contributed to increased sediment loads in the historic period.

You might be interested in
When completing a dressing change, the nurse notes that the wound has proud flesh. which is the appropriate action by the nurse?
Fantom [35]
The nurse should request surgical consult--The most appropriate action by the nurse is to request a surgical consult proud flesh refers to an excess of granulation tissue that will require surgical removal or chemical cauterization of the defect to allow healing to proceed.

Hope this helps please hit the thank you button.
4 0
2 years ago
Please help me asap! Thank youuu, you saved me!
abruzzese [7]

Answer: God bless you

Explanation:

6 0
2 years ago
How are ecological islands different from geographical islands?
Gre4nikov [31]

Ecological islands is just a terminology used, since it isn't surrounded by water like an actual island, instead, it's something isolated from other things, which is the same thing as an island in a way:

Island (geographical) - Land isolated from bigger "main" land masses by water.

Island (ecological) - Land which contains certain isolated features (habitat, plants, etc.).



Hope it helped,




BioTeacher101


3 0
2 years ago
Which is the correct symbol for an isotope of iodine with 53 protons and 78 neutrons?
nexus9112 [7]
The correct symbol of Iodine with 53 protons and 78 neutrons is shown below.
The symbols comprises two numbers.

Atomic Number:
                         The number highlighted BLUE is the atomic number of Iodine. Atomic number shows the number o protons present in the nucleus.

Mass Number:
                      The number highlighted in RED is the mass number of given Iodine. Mass number is the sum of protons and neutrons present in the nucleus. So,

                     Mass Number  =  # of Protons  +  # of Neutrons

                     Mass Number  =  53  +  78

                     Mass Number  =  131

6 0
2 years ago
Read 2 more answers
What different between an animal cell and a plant cell?
Stolb23 [73]

Answer:

plant cells have a cell wall and animal cells dont

7 0
1 year ago
Read 2 more answers
Other questions:
  • Explain the connection between the beginning of life and the universal genetic code
    8·1 answer
  • Cholesterol is a. not essential in the diet; the human body can synthesize it b. all of these choices are correct c. not found i
    10·1 answer
  • One predator-prey relationship that currently exists and how the population of one of the species affect the population of the o
    13·1 answer
  • Eddie is authoring a book for kids on plants. What point should he include in his book?
    11·1 answer
  • Which of the following prevent uncontrolled cell growth (cancer)?
    6·1 answer
  • -
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • 3. Predict: Based on your hypothesis, predict how changing the rabbit population will affect the
    15·1 answer
  • Which statement correctly describes a reaction that forms a biological
    13·1 answer
  • (I'll give Brainliest to whoever replies the faster)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!