Answer:
chemical weathering
In warmer climates, chemical weathering is more rapid because the chemical reactions that dissolve rocks and minerals are accelerated by warm temperatures.
Answer:
ydropower, electricity produced from generators driven by turbines that convert the potential energy of falling or fast-flowing water into mechanical energy
Explanation:
In the generation of hydroelectric power, water is collected or stored at a higher elevation and led downward through large pipes or tunnels (penstocks) to a lower elevation; the difference in these two elevations is known as the head. At the end of its passage down the pipes, the falling water causes turbines to rotate. The turbines in turn drive generators, which convert the turbines’ mechanical energy into electricity. Transformers are then used to convert the alternating voltage suitable for the generators to a higher voltage suitable for long-distance transmission. The structure that houses the turbines and generators, and into which the pipes or penstocks feed, is called the powerhouse.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The combination of drought and poor land use practice created the the dust bowl.
Answer:
cnidarians most commonly reproduce asexually
