The existence of the cell was unknow before the invention of what ?

1 answer:

3 0

Microscopes

Before the development of microscopes, the existence of cellular life was unknown. By examining a piece of cork, Robert Hooke first saw and named cells. Antony van Leeuwenhoek was the first person to see living cells.

You might be interested in

Where would they be found

Gennadij [26K]

Answer:

My answer would also be as yours

Explanation:

at the bottom of the ocean

4 0

3 years ago

Emotional response of teenage girls

maksim [4K]

What do you mean by that

7 0

3 years ago

Describe ecosystem Please.

astraxan [27]

Answer: An ecosystem is a community of living organisms in conjunction with the nonliving components of their environment, interacting as a system. These biotic and abiotic components are linked together through nutrient cycles and energy flows. Energy enters the system through photosynthesis and is incorporated into plant tissue. By feeding on plants and on one another, animals play an important role in the movement of matter and energy through the system. They also influence the quantity of plant and microbial biomass present. By breaking down dead organic matter, decomposers release carbon back to the atmosphere and facilitate nutrient cycling by converting nutrients stored in dead biomass back to a form that can be readily used by plants and other microbes.

Explanation:

hope this helps!!

3 0

3 years ago

Parasitism is considered a(n) _________ limited factor. abiotic natural biotic abiotic and biotic

Bas_tet [7]

The answer is abiotic.

5 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago