1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
2 years ago
10

"At Jane's school, it was against the rules to have your phone on you. Phones were to be kept off and in your locker." Which wor

ds give us clues that the setting is the present time?
1. Jane's school
2. Phones were to be kept off
3. against the rules
4. locker
Biology
2 answers:
mojhsa [17]2 years ago
7 0
Phones were kept off
3241004551 [841]2 years ago
3 0

Answer:

Phones were to be kept off

You might be interested in
The reproductive system in both males and females are controlled and regulated by the interaction of hormones from the hypothala
sweet-ann [11.9K]

The reproductive system in both males and females are controlled and regulated by the interaction of hormones from the hypothalamus and pituitary glands with hormones from the reproductive organs. How do these hormones affect the development of male and female reproductive systems

4 0
2 years ago
What controls the function of the cell
blsea [12.9K]
The nucleus because it is the brain of the cell, it's what controls it.
4 0
3 years ago
40. For the following give the mRNA, tRNA and amino acid (a.a.) sequence that will be created:
Delicious77 [7]
There were 4 proteins that were created.
5 0
3 years ago
Which mental health professional is most likely to take a biological approach to understanding?
Natasha_Volkova [10]
Are you a college student
4 0
3 years ago
Viruses are parasitic, in that they require a host cell in order to go through the process of reproduction.
Irina-Kira [14]
Influenza is an example of lytic virus wherein it attach to a host, enter and degradation of the host's DNA is a subsequent step in order for it to reproduce. The new virus is synthesize by duplication of virus' genetic material and creation of new viral parts. 
8 0
3 years ago
Other questions:
  • Mandatory labeling of foods is regulated by the ________.
    14·1 answer
  • Mount Tambora in Indonesia erupted and caused the "Year without a Summer." Over 100,000 people died from starvation because of t
    15·1 answer
  • Why might it be advantageous for a storage polysaccharide to have a branched-chain structure instead of a linear structure?
    14·2 answers
  • Rahul gets a cut around his wrist such taht blood starts flowing out. rahul has a disorder due to which number of platelets in b
    9·1 answer
  • PLEASE ANSWER ASAP!!!
    11·1 answer
  • Groups of specilized cells working together are called
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which term describes the chromosomal abnormality of having extra chromosomes?
    9·1 answer
  • Which statements best describe the two methods of reproduction?
    10·1 answer
  • Snapdragons show incomplete dominance in their flowers. A pink snapdragon is crossed with a red snapdragon. What color(s) are th
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!