1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
14

An essay about AuthaGrpah, and why is the best projection map?​

Biology
1 answer:
maw [93]3 years ago
6 0

Explanation:

AuthaGraph is an approximately equal-area world map projection invented by Japanese architect Hajime Narukawa[1] in 1999.[2] The map is made by equally dividing a spherical surface into 96 triangles, transferring it to a tetrahedron while maintaining area proportions, and unfolding it onto a rectangle. The map substantially preserves sizes and shapes of all continents and oceans while it reduces distortions of their shapes, as inspired by the Dymaxion map. The projection does not have some of the major distortions of the Mercator projection, like the expansion of countries in far northern latitudes, and allows for Antarctica to be displayed accurately and in whole.[3] Triangular world maps are also possible using the same method. The name is derived from "authalic" and "graph".

You might be interested in
What is the voltage across a membrane called?
Marina86 [1]
It is called a cell membrane potential
3 0
3 years ago
PLS HELP!! ASAP DUE TONIGHT!!
guapka [62]

Answer:

D. a higher number of double bonds between carbon atoms in their structures.

Explanation:

7 0
3 years ago
The spread of roots around a plant is usually greater than the depth of the roots.
valina [46]
The spread of roots around a plant is usually greater than the depth of the roots is a completely false statement. It totally depends on the type of plant in regards to the type of root it will have. Normally there are two kinds of roots and they are taproot and fibrous roots. In case of taproots the main root goes downwards and smaller roots branches out of it. In case of taproots, it is true that the spread of roots is smaller than the depth of the roots. In case of fibrous roots, the spread of roots is greater than that of the depth of the roots. A wig tree is an example of a plant having taproot. in the wig tree the root can go to a depth of around 120 meters.
6 0
4 years ago
Read 2 more answers
In an experimental situation, a student researcher inserts an mRNA molecule into a eukaryotic cell after he has removed its 5' c
Scorpion4ik [409]
I found (D) to be correct
3 0
3 years ago
What is a niche??????????
Juli2301 [7.4K]
I have no idea search it up in google
6 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is preparing to measure a client's temperature. what is the first thing that the nurse should do to ensure an accurate
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • a human skin cell contains 46 chromosomes. A frog sprem cell conrains 12 chromosomes. which paie of number of a normal gamete fr
    7·1 answer
  • Why do scientists think that RNA may have evolved before DNA?
    14·1 answer
  • Your hypothesis should be based on_____________?
    14·1 answer
  • What alcohol is found in triglyceride?
    9·1 answer
  • The process that uses carbon dioxide but not light energy to make sugars is called
    7·2 answers
  • Which of the following provides the best summary of the process of natural
    15·1 answer
  • What does DNA have to do before a cell divides?
    8·1 answer
  • Which of the following occurs during<br> Prophase?<br><br> Answer: Nuclear envelope breaks down!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!