All categories

3 years ago

Find the correct answer:Gases A and B move by -diffusion-osmosis-respiration

Biology

2 answers:

katrin [286]3 years ago

4 0

Answer:

Diffusion

Explanation:

$.$

Vlada [557]3 years ago

4 0

Answer:

diffusion because it's the net movement of molecules from an are where they are at a higher concentration to and area where they are of lower concentration ....

You might be interested in

PLSSS HELP ILL GIVE 100 POINTS PLSSS HELPPP

navik [9.2K]

Answer:

TGCA

Explanation:

3 0

3 years ago

Photosynthesis is the process by which plants and algae use energy from the sun to synthesize which of the following?

Softa [21]

Photosynthesis takes within the CO2 produced by all breathing organisms and reintroduces oxygen into the atmosphere. Photosynthesis is that the process employed by plants, algae and certain bacteria to harness energy from sunlight and switch it into energy

5 0

3 years ago

Bones of vertebral column form what cavity

12345 [234]

The spinal cavity ,is enclosed within the vertebral foramen of the vertebrae

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

1. What function do photoreceptor cells perform?

Eddi Din [679]

Answer:

The correct answer is 3 They detect light,allowing the spiders to see colors.

Explanation:

Photoreceptors are also called transducin presnt in the rod cells of retina and play an important role in vision.

The phoreceptor is a G protein coupled receptor that contain GDP.When light strikes the eye the GDP is coverted to GTP resulting in the activation of the photo receptors.

The activation of photo receptors result in the closure of Na+ ion channels leading to hyperpolarization caused by lowering the cellular label of cGMP by the activation of phosphodiesterase enzyme.

This ultimately result in the formation of 5"GMP.

5 0

4 years ago

Find the correct answer:Gases A and B move by -diffusion-osmosis-respiration​

Find the correct answer:Gases A and B move by -diffusion-osmosis-respiration